Incidental Mutation 'R6618:Pigs'
ID524221
Institutional Source Beutler Lab
Gene Symbol Pigs
Ensembl Gene ENSMUSG00000041958
Gene Namephosphatidylinositol glycan anchor biosynthesis, class S
SynonymsLOC245087, LOC276846
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R6618 (G1)
Quality Score157.009
Status Validated
Chromosome11
Chromosomal Location78328415-78342782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78341230 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 396 (L396P)
Ref Sequence ENSEMBL: ENSMUSP00000044871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002127] [ENSMUST00000048073] [ENSMUST00000108295]
Predicted Effect probably benign
Transcript: ENSMUST00000002127
SMART Domains Protein: ENSMUSP00000002127
Gene: ENSMUSG00000002058

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 78 237 1.6e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048073
AA Change: L396P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044871
Gene: ENSMUSG00000041958
AA Change: L396P

DomainStartEndE-ValueType
Pfam:PIG-S 22 547 3.3e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108295
SMART Domains Protein: ENSMUSP00000103930
Gene: ENSMUSG00000002058

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 80 212 1.3e-60 PFAM
Pfam:GMP_PDE_delta 218 258 1.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154700
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1b2 T C 11: 69,603,463 D68G probably damaging Het
Barx2 G A 9: 31,846,872 L257F probably benign Het
Bbx C G 16: 50,266,263 W90S probably damaging Het
Bmp1 T A 14: 70,491,368 D588V probably damaging Het
Caskin2 C T 11: 115,800,029 M1188I possibly damaging Het
Ccdc180 T A 4: 45,950,708 I1651N probably damaging Het
Cr2 T C 1: 195,157,379 D580G probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Fam166a C A 2: 25,220,623 L148M probably benign Het
Fam204a T C 19: 60,220,637 probably null Het
Fam71b A G 11: 46,407,299 T477A probably damaging Het
Fam83h T C 15: 76,003,511 D659G probably damaging Het
Hells G T 19: 38,957,084 R589L probably benign Het
Helz A G 11: 107,599,150 T144A probably benign Het
Il1r1 T A 1: 40,300,811 V258D probably damaging Het
Isoc2a A T 7: 4,895,326 I183F probably benign Het
Kat2a G T 11: 100,712,370 probably benign Het
Klf9 A G 19: 23,164,871 M232V probably benign Het
Lars G T 18: 42,244,908 S147R possibly damaging Het
Mfsd7a G T 5: 108,443,098 T400K probably benign Het
Mkrn3 A G 7: 62,419,033 F337L probably benign Het
Mrc2 A T 11: 105,349,882 N1466I probably damaging Het
Myo5c G A 9: 75,275,637 probably null Het
Prkcb G A 7: 122,627,663 R624Q probably benign Het
R3hdm1 T C 1: 128,193,565 S269P probably benign Het
Racgap1 A T 15: 99,623,994 I505K probably damaging Het
Ralgds T A 2: 28,550,511 D777E probably benign Het
Rdh14 A G 12: 10,395,123 I325V probably benign Het
Rpn2 T A 2: 157,321,861 H624Q probably benign Het
Scarb1 C T 5: 125,304,330 S50N probably damaging Het
Shmt1 T C 11: 60,792,946 probably null Het
Smim24 A G 10: 81,394,132 N27S possibly damaging Het
Snx13 A G 12: 35,112,445 D550G probably damaging Het
Tnfsf18 T A 1: 161,494,780 L23* probably null Het
Trpc3 T A 3: 36,640,695 K703N possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Zfy2 A G Y: 2,121,477 S139P probably benign Homo
Other mutations in Pigs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Pigs APN 11 78340031 missense probably benign
feral UTSW 11 78336739 missense possibly damaging 0.94
R0094:Pigs UTSW 11 78340038 missense probably damaging 0.98
R0490:Pigs UTSW 11 78335625 missense probably damaging 1.00
R1027:Pigs UTSW 11 78336825 missense probably damaging 1.00
R1073:Pigs UTSW 11 78335605 missense probably benign 0.09
R1157:Pigs UTSW 11 78328994 missense possibly damaging 0.87
R1754:Pigs UTSW 11 78337847 missense probably damaging 0.99
R1881:Pigs UTSW 11 78341756 missense probably benign 0.00
R2171:Pigs UTSW 11 78328812 missense probably damaging 1.00
R2386:Pigs UTSW 11 78332986 missense probably damaging 1.00
R4928:Pigs UTSW 11 78329002 missense probably damaging 0.99
R5206:Pigs UTSW 11 78333723 missense probably damaging 0.98
R5480:Pigs UTSW 11 78329075 missense possibly damaging 0.58
R5665:Pigs UTSW 11 78328769 synonymous probably null
R6039:Pigs UTSW 11 78341825 missense probably damaging 1.00
R6039:Pigs UTSW 11 78341825 missense probably damaging 1.00
R6159:Pigs UTSW 11 78328500 missense probably benign 0.01
R6572:Pigs UTSW 11 78339364 missense probably damaging 0.98
R7052:Pigs UTSW 11 78341385 missense probably damaging 1.00
R7065:Pigs UTSW 11 78336739 missense possibly damaging 0.94
R7352:Pigs UTSW 11 78328812 missense probably damaging 1.00
R7851:Pigs UTSW 11 78336787 missense probably damaging 1.00
R7934:Pigs UTSW 11 78336787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAAACTAAGTTGGGGCTCCC -3'
(R):5'- CAATGTTGCTGATCTTCCCCAG -3'

Sequencing Primer
(F):5'- GGGGCTCCCAGAAACACTTC -3'
(R):5'- CAGAAGCTGGGCCAGGG -3'
Posted On2018-06-22