Incidental Mutation 'R6618:Helz'
ID524224
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6618 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107599150 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 144 (T144A)
Ref Sequence ENSEMBL: ENSMUSP00000102357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746]
Predicted Effect probably benign
Transcript: ENSMUST00000075012
AA Change: T144A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721
AA Change: T144A

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100305
AA Change: T144A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721
AA Change: T144A

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106746
AA Change: T144A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721
AA Change: T144A

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1b2 T C 11: 69,603,463 D68G probably damaging Het
Barx2 G A 9: 31,846,872 L257F probably benign Het
Bbx C G 16: 50,266,263 W90S probably damaging Het
Bmp1 T A 14: 70,491,368 D588V probably damaging Het
Caskin2 C T 11: 115,800,029 M1188I possibly damaging Het
Ccdc180 T A 4: 45,950,708 I1651N probably damaging Het
Cr2 T C 1: 195,157,379 D580G probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Fam166a C A 2: 25,220,623 L148M probably benign Het
Fam204a T C 19: 60,220,637 probably null Het
Fam71b A G 11: 46,407,299 T477A probably damaging Het
Fam83h T C 15: 76,003,511 D659G probably damaging Het
Hells G T 19: 38,957,084 R589L probably benign Het
Il1r1 T A 1: 40,300,811 V258D probably damaging Het
Isoc2a A T 7: 4,895,326 I183F probably benign Het
Kat2a G T 11: 100,712,370 probably benign Het
Klf9 A G 19: 23,164,871 M232V probably benign Het
Lars G T 18: 42,244,908 S147R possibly damaging Het
Mfsd7a G T 5: 108,443,098 T400K probably benign Het
Mkrn3 A G 7: 62,419,033 F337L probably benign Het
Mrc2 A T 11: 105,349,882 N1466I probably damaging Het
Myo5c G A 9: 75,275,637 probably null Het
Pigs T C 11: 78,341,230 L396P probably damaging Het
Prkcb G A 7: 122,627,663 R624Q probably benign Het
R3hdm1 T C 1: 128,193,565 S269P probably benign Het
Racgap1 A T 15: 99,623,994 I505K probably damaging Het
Ralgds T A 2: 28,550,511 D777E probably benign Het
Rdh14 A G 12: 10,395,123 I325V probably benign Het
Rpn2 T A 2: 157,321,861 H624Q probably benign Het
Scarb1 C T 5: 125,304,330 S50N probably damaging Het
Shmt1 T C 11: 60,792,946 probably null Het
Smim24 A G 10: 81,394,132 N27S possibly damaging Het
Snx13 A G 12: 35,112,445 D550G probably damaging Het
Tnfsf18 T A 1: 161,494,780 L23* probably null Het
Trpc3 T A 3: 36,640,695 K703N possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Zfy2 A G Y: 2,121,477 S139P probably benign Homo
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0328:Helz UTSW 11 107604348 missense probably benign 0.30
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R4930:Helz UTSW 11 107620168 missense probably damaging 0.99
R5078:Helz UTSW 11 107656096 missense probably damaging 1.00
R5446:Helz UTSW 11 107632204 missense probably damaging 1.00
R5535:Helz UTSW 11 107646120 missense probably damaging 0.98
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7513:Helz UTSW 11 107656115 missense probably damaging 0.99
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R7780:Helz UTSW 11 107637863 missense probably damaging 1.00
R8024:Helz UTSW 11 107686421 missense unknown
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- TACCATGTTTTAGCAGTGACCAC -3'
(R):5'- AGGTCCCAGAGAAAGATCTGC -3'

Sequencing Primer
(F):5'- GTTTTAGCAGTGACCACAGAGTC -3'
(R):5'- GTCCCAGAGAAAGATCTGCTTCCTC -3'
Posted On2018-06-22