Incidental Mutation 'R6583:Pnmal2'
ID524230
Institutional Source Beutler Lab
Gene Symbol Pnmal2
Ensembl Gene ENSMUSG00000070802
Gene NamePNMA-like 2
SynonymsEG434128
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6583 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location16944682-16948828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16945919 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 276 (N276S)
Ref Sequence ENSEMBL: ENSMUSP00000092401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094807]
Predicted Effect probably damaging
Transcript: ENSMUST00000094807
AA Change: N276S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092401
Gene: ENSMUSG00000070802
AA Change: N276S

DomainStartEndE-ValueType
Pfam:PNMA 1 152 4.1e-36 PFAM
low complexity region 172 196 N/A INTRINSIC
internal_repeat_1 239 296 1.86e-6 PROSPERO
SCOP:d1qbkb_ 309 331 2e-3 SMART
internal_repeat_1 343 402 1.86e-6 PROSPERO
low complexity region 445 454 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 518 551 N/A INTRINSIC
low complexity region 571 596 N/A INTRINSIC
low complexity region 612 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A C 3: 127,016,964 I491S probably damaging Het
Armc12 A T 17: 28,538,614 Q240L probably null Het
Cntnap5c C T 17: 58,330,277 P1050S probably damaging Het
Col4a3 C A 1: 82,641,476 A42E unknown Het
D630003M21Rik A G 2: 158,220,516 V28A probably damaging Het
Dbf4 A G 5: 8,398,143 S355P probably damaging Het
Dnah6 A G 6: 73,173,533 V749A probably benign Het
Exoc4 T C 6: 33,815,753 L606P probably damaging Het
Fggy T C 4: 95,600,973 S109P probably benign Het
Gdf7 T A 12: 8,301,758 Q59L unknown Het
M6pr T C 6: 122,313,390 V104A probably damaging Het
Macf1 A T 4: 123,470,946 probably null Het
Micu2 T C 14: 57,943,670 K169R probably damaging Het
Mthfd1l A G 10: 4,047,937 D636G probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nfib T G 4: 82,498,471 D125A probably damaging Het
Nuf2 T C 1: 169,504,548 T393A probably benign Het
Olfr913 G A 9: 38,594,964 V248I possibly damaging Het
Paox T A 7: 140,126,378 N70K probably damaging Het
Ralgds G A 2: 28,533,644 A32T probably damaging Het
Samd11 T A 4: 156,248,134 N446I possibly damaging Het
Soat1 T C 1: 156,466,492 probably null Het
Tmem87a A T 2: 120,375,477 V339E possibly damaging Het
Tmprss13 G T 9: 45,345,305 C516F probably damaging Het
Vmn2r69 T C 7: 85,409,809 T515A probably benign Het
Xrcc5 T C 1: 72,312,593 probably null Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zfp964 G T 8: 69,662,983 D78Y probably damaging Het
Other mutations in Pnmal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Pnmal2 APN 7 16945163 missense unknown
IGL02023:Pnmal2 APN 7 16945691 missense probably damaging 0.97
FR4737:Pnmal2 UTSW 7 16946006 small deletion probably benign
R0085:Pnmal2 UTSW 7 16945549 missense unknown
R2069:Pnmal2 UTSW 7 16945789 missense probably damaging 0.99
R2151:Pnmal2 UTSW 7 16945912 missense probably benign 0.00
R2321:Pnmal2 UTSW 7 16945565 missense unknown
R2929:Pnmal2 UTSW 7 16946692 missense possibly damaging 0.93
R3738:Pnmal2 UTSW 7 16946596 missense probably benign 0.00
R3739:Pnmal2 UTSW 7 16946596 missense probably benign 0.00
R5185:Pnmal2 UTSW 7 16945976 missense probably damaging 1.00
R5259:Pnmal2 UTSW 7 16945274 missense unknown
R5908:Pnmal2 UTSW 7 16947043 missense unknown
R5943:Pnmal2 UTSW 7 16946437 missense probably benign 0.25
R6101:Pnmal2 UTSW 7 16946568 missense probably benign 0.20
R6260:Pnmal2 UTSW 7 16946233 missense probably benign 0.03
R7007:Pnmal2 UTSW 7 16946256 missense possibly damaging 0.68
R7497:Pnmal2 UTSW 7 16944949 start gained probably benign
R8231:Pnmal2 UTSW 7 16946590 missense probably benign 0.01
R8278:Pnmal2 UTSW 7 16946338 missense probably damaging 0.99
RF003:Pnmal2 UTSW 7 16946016 small insertion probably benign
Z1176:Pnmal2 UTSW 7 16946810 missense possibly damaging 0.93
Z1177:Pnmal2 UTSW 7 16946968 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTGAGCGTAGATGAAGACCAG -3'
(R):5'- TCGGGGCTATCCATCACTTC -3'

Sequencing Primer
(F):5'- AGACCAGAGGGCCCTGTATG -3'
(R):5'- CCATTTTCCAGAGACTCGCTG -3'
Posted On2018-06-22