Incidental Mutation 'R6618:Bmp1'
ID524233
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Namebone morphogenetic protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6618 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70474558-70520234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70491368 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 588 (D588V)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
Predicted Effect probably damaging
Transcript: ENSMUST00000022693
AA Change: D588V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: D588V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226601
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228501
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1b2 T C 11: 69,603,463 D68G probably damaging Het
Barx2 G A 9: 31,846,872 L257F probably benign Het
Bbx C G 16: 50,266,263 W90S probably damaging Het
Caskin2 C T 11: 115,800,029 M1188I possibly damaging Het
Ccdc180 T A 4: 45,950,708 I1651N probably damaging Het
Cr2 T C 1: 195,157,379 D580G probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Fam166a C A 2: 25,220,623 L148M probably benign Het
Fam204a T C 19: 60,220,637 probably null Het
Fam71b A G 11: 46,407,299 T477A probably damaging Het
Fam83h T C 15: 76,003,511 D659G probably damaging Het
Hells G T 19: 38,957,084 R589L probably benign Het
Helz A G 11: 107,599,150 T144A probably benign Het
Il1r1 T A 1: 40,300,811 V258D probably damaging Het
Isoc2a A T 7: 4,895,326 I183F probably benign Het
Kat2a G T 11: 100,712,370 probably benign Het
Klf9 A G 19: 23,164,871 M232V probably benign Het
Lars G T 18: 42,244,908 S147R possibly damaging Het
Mfsd7a G T 5: 108,443,098 T400K probably benign Het
Mkrn3 A G 7: 62,419,033 F337L probably benign Het
Mrc2 A T 11: 105,349,882 N1466I probably damaging Het
Myo5c G A 9: 75,275,637 probably null Het
Pigs T C 11: 78,341,230 L396P probably damaging Het
Prkcb G A 7: 122,627,663 R624Q probably benign Het
R3hdm1 T C 1: 128,193,565 S269P probably benign Het
Racgap1 A T 15: 99,623,994 I505K probably damaging Het
Ralgds T A 2: 28,550,511 D777E probably benign Het
Rdh14 A G 12: 10,395,123 I325V probably benign Het
Rpn2 T A 2: 157,321,861 H624Q probably benign Het
Scarb1 C T 5: 125,304,330 S50N probably damaging Het
Shmt1 T C 11: 60,792,946 probably null Het
Smim24 A G 10: 81,394,132 N27S possibly damaging Het
Snx13 A G 12: 35,112,445 D550G probably damaging Het
Tnfsf18 T A 1: 161,494,780 L23* probably null Het
Trpc3 T A 3: 36,640,695 K703N possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Zfy2 A G Y: 2,121,477 S139P probably benign Homo
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70492461 missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70486220 missense probably damaging 0.97
IGL02065:Bmp1 APN 14 70490107 missense probably damaging 0.99
IGL02349:Bmp1 APN 14 70507549 missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70504776 missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70490029 missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70490034 missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70508004 missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70486265 missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70508831 missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70486272 missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70492107 missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70490542 splice site probably null
R4609:Bmp1 UTSW 14 70477966 missense probably benign 0.00
R4613:Bmp1 UTSW 14 70508523 missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70492844 missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70492073 splice site probably null
R4884:Bmp1 UTSW 14 70475215 missense probably benign 0.01
R4905:Bmp1 UTSW 14 70491362 missense probably benign 0.06
R5088:Bmp1 UTSW 14 70486219 missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70480165 missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70508128 missense probably benign 0.34
R5625:Bmp1 UTSW 14 70486166 missense probably benign 0.19
R5653:Bmp1 UTSW 14 70490094 missense probably benign 0.00
R6155:Bmp1 UTSW 14 70508007 missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70491383 missense possibly damaging 0.88
R6649:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70508858 missense probably benign 0.26
R6983:Bmp1 UTSW 14 70508207 missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70479560 missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70490122 missense probably benign 0.44
R7716:Bmp1 UTSW 14 70477922 nonsense probably null
X0028:Bmp1 UTSW 14 70508537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATCACACCCTGCCAGTG -3'
(R):5'- ACTCCTCTCTGCAACATGGG -3'

Sequencing Primer
(F):5'- ACACCCTGCCAGTGTTCTG -3'
(R):5'- GGGCCATAGGAACTTGAACCTC -3'
Posted On2018-06-22