Mutagenetix > Incidental Mutation

Incidental Mutation 'R6618:Bmp1'

524233

Institutional Source

Beutler Lab

Gene Symbol

Bmp1

Ensembl Gene

ENSMUSG00000022098

Gene Name

bone morphogenetic protein 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6618 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70474558-70520234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70491368 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 588 (D588V)

Ref Sequence

ENSEMBL: ENSMUSP00000022693 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]

AlphaFold

P98063

Predicted Effect

probably damaging
Transcript: ENSMUST00000022693
AA Change: D588V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: D588V

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
ZnMc	131	273	1.32e-54	SMART
CUB	327	439	4.35e-43	SMART
CUB	440	552	7.86e-50	SMART
EGF_CA	552	593	5.03e-11	SMART
CUB	596	708	1.13e-50	SMART
EGF_CA	708	748	4.81e-8	SMART
CUB	752	864	3.99e-51	SMART
CUB	865	981	7.35e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226601

Predicted Effect

probably benign
Transcript: ENSMUST00000226906

Predicted Effect

probably benign
Transcript: ENSMUST00000227944

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228501

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp1b2	T	C	11: 69,603,463	D68G	probably damaging	Het
Barx2	G	A	9: 31,846,872	L257F	probably benign	Het
Bbx	C	G	16: 50,266,263	W90S	probably damaging	Het
Caskin2	C	T	11: 115,800,029	M1188I	possibly damaging	Het
Ccdc180	T	A	4: 45,950,708	I1651N	probably damaging	Het
Cr2	T	C	1: 195,157,379	D580G	probably damaging	Het
Crebbp	C	T	16: 4,119,806	A698T	possibly damaging	Het
Fam166a	C	A	2: 25,220,623	L148M	probably benign	Het
Fam204a	T	C	19: 60,220,637		probably null	Het
Fam71b	A	G	11: 46,407,299	T477A	probably damaging	Het
Fam83h	T	C	15: 76,003,511	D659G	probably damaging	Het
Hells	G	T	19: 38,957,084	R589L	probably benign	Het
Helz	A	G	11: 107,599,150	T144A	probably benign	Het
Il1r1	T	A	1: 40,300,811	V258D	probably damaging	Het
Isoc2a	A	T	7: 4,895,326	I183F	probably benign	Het
Kat2a	G	T	11: 100,712,370		probably benign	Het
Klf9	A	G	19: 23,164,871	M232V	probably benign	Het
Lars	G	T	18: 42,244,908	S147R	possibly damaging	Het
Mfsd7a	G	T	5: 108,443,098	T400K	probably benign	Het
Mkrn3	A	G	7: 62,419,033	F337L	probably benign	Het
Mrc2	A	T	11: 105,349,882	N1466I	probably damaging	Het
Myo5c	G	A	9: 75,275,637		probably null	Het
Pigs	T	C	11: 78,341,230	L396P	probably damaging	Het
Prkcb	G	A	7: 122,627,663	R624Q	probably benign	Het
R3hdm1	T	C	1: 128,193,565	S269P	probably benign	Het
Racgap1	A	T	15: 99,623,994	I505K	probably damaging	Het
Ralgds	T	A	2: 28,550,511	D777E	probably benign	Het
Rdh14	A	G	12: 10,395,123	I325V	probably benign	Het
Rpn2	T	A	2: 157,321,861	H624Q	probably benign	Het
Scarb1	C	T	5: 125,304,330	S50N	probably damaging	Het
Shmt1	T	C	11: 60,792,946		probably null	Het
Smim24	A	G	10: 81,394,132	N27S	possibly damaging	Het
Snx13	A	G	12: 35,112,445	D550G	probably damaging	Het
Tnfsf18	T	A	1: 161,494,780	L23*	probably null	Het
Trpc3	T	A	3: 36,640,695	K703N	possibly damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Zfy2	A	G	Y: 2,121,477	S139P	probably benign	Homo

Other mutations in Bmp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Bmp1	APN	14	70492461	missense	probably damaging	1.00
IGL02065:Bmp1	APN	14	70486220	missense	probably damaging	0.97
IGL02065:Bmp1	APN	14	70490107	missense	probably damaging	0.99
IGL02349:Bmp1	APN	14	70507549	missense	possibly damaging	0.61
IGL02486:Bmp1	APN	14	70504776	missense	possibly damaging	0.48
PIT4519001:Bmp1	UTSW	14	70490029	missense	possibly damaging	0.65
R0394:Bmp1	UTSW	14	70490034	missense	probably damaging	0.99
R1371:Bmp1	UTSW	14	70492466	missense	probably damaging	1.00
R1604:Bmp1	UTSW	14	70508004	missense	possibly damaging	0.66
R1732:Bmp1	UTSW	14	70486265	missense	possibly damaging	0.67
R1834:Bmp1	UTSW	14	70508831	missense	possibly damaging	0.73
R2008:Bmp1	UTSW	14	70492466	missense	probably damaging	1.00
R2197:Bmp1	UTSW	14	70486272	missense	possibly damaging	0.83
R3157:Bmp1	UTSW	14	70492107	missense	possibly damaging	0.63
R4397:Bmp1	UTSW	14	70490542	splice site	probably null
R4609:Bmp1	UTSW	14	70477966	missense	probably benign	0.00
R4613:Bmp1	UTSW	14	70508523	missense	probably damaging	1.00
R4675:Bmp1	UTSW	14	70492844	missense	probably damaging	0.99
R4796:Bmp1	UTSW	14	70492073	splice site	probably null
R4884:Bmp1	UTSW	14	70475215	missense	probably benign	0.01
R4905:Bmp1	UTSW	14	70491362	missense	probably benign	0.06
R5088:Bmp1	UTSW	14	70486219	missense	possibly damaging	0.84
R5225:Bmp1	UTSW	14	70480165	missense	probably damaging	0.97
R5271:Bmp1	UTSW	14	70508128	missense	probably benign	0.34
R5625:Bmp1	UTSW	14	70486166	missense	probably benign	0.19
R5653:Bmp1	UTSW	14	70490094	missense	probably benign	0.00
R6155:Bmp1	UTSW	14	70508007	missense	probably damaging	1.00
R6295:Bmp1	UTSW	14	70491383	missense	possibly damaging	0.88
R6649:Bmp1	UTSW	14	70490618	missense	probably damaging	1.00
R6653:Bmp1	UTSW	14	70490618	missense	probably damaging	1.00
R6951:Bmp1	UTSW	14	70508858	missense	probably benign	0.26
R6983:Bmp1	UTSW	14	70508207	missense	probably damaging	0.96
R7207:Bmp1	UTSW	14	70479560	missense	possibly damaging	0.56
R7500:Bmp1	UTSW	14	70490122	missense	probably benign	0.44
R7716:Bmp1	UTSW	14	70477922	nonsense	probably null
R7749:Bmp1	UTSW	14	70492844	missense	probably damaging	1.00
R7763:Bmp1	UTSW	14	70492084	missense	probably damaging	1.00
R7834:Bmp1	UTSW	14	70508565	missense	probably damaging	1.00
R8232:Bmp1	UTSW	14	70519889	missense	probably damaging	0.97
R8490:Bmp1	UTSW	14	70490133	missense	possibly damaging	0.94
R8827:Bmp1	UTSW	14	70490642	missense	probably damaging	1.00
R8945:Bmp1	UTSW	14	70490190	missense	probably damaging	1.00
R9178:Bmp1	UTSW	14	70490173	missense	possibly damaging	0.78
R9228:Bmp1	UTSW	14	70519898	missense	probably benign
R9621:Bmp1	UTSW	14	70477866	missense	probably benign	0.29
R9652:Bmp1	UTSW	14	70477920	missense	probably damaging	1.00
X0028:Bmp1	UTSW	14	70508537	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTATCACACCCTGCCAGTG -3'
(R):5'- ACTCCTCTCTGCAACATGGG -3'

Sequencing Primer
(F):5'- ACACCCTGCCAGTGTTCTG -3'
(R):5'- GGGCCATAGGAACTTGAACCTC -3'

Posted On

2018-06-22