Incidental Mutation 'R6583:Olfr913'
ID524238
Institutional Source Beutler Lab
Gene Symbol Olfr913
Ensembl Gene ENSMUSG00000059189
Gene Nameolfactory receptor 913
SynonymsMOR165-9P, GA_x6K02T2PVTD-32296575-32297513, MOR165-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6583 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38592759-38596283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38594964 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 248 (V248I)
Ref Sequence ENSEMBL: ENSMUSP00000079876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081095
AA Change: V248I

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079876
Gene: ENSMUSG00000059189
AA Change: V248I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-49 PFAM
Pfam:7tm_1 41 290 3.9e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A C 3: 127,016,964 I491S probably damaging Het
Armc12 A T 17: 28,538,614 Q240L probably null Het
Cntnap5c C T 17: 58,330,277 P1050S probably damaging Het
Col4a3 C A 1: 82,641,476 A42E unknown Het
D630003M21Rik A G 2: 158,220,516 V28A probably damaging Het
Dbf4 A G 5: 8,398,143 S355P probably damaging Het
Dnah6 A G 6: 73,173,533 V749A probably benign Het
Exoc4 T C 6: 33,815,753 L606P probably damaging Het
Fggy T C 4: 95,600,973 S109P probably benign Het
Gdf7 T A 12: 8,301,758 Q59L unknown Het
M6pr T C 6: 122,313,390 V104A probably damaging Het
Macf1 A T 4: 123,470,946 probably null Het
Micu2 T C 14: 57,943,670 K169R probably damaging Het
Mthfd1l A G 10: 4,047,937 D636G probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nfib T G 4: 82,498,471 D125A probably damaging Het
Nuf2 T C 1: 169,504,548 T393A probably benign Het
Paox T A 7: 140,126,378 N70K probably damaging Het
Pnmal2 A G 7: 16,945,919 N276S probably damaging Het
Ralgds G A 2: 28,533,644 A32T probably damaging Het
Samd11 T A 4: 156,248,134 N446I possibly damaging Het
Soat1 T C 1: 156,466,492 probably null Het
Tmem87a A T 2: 120,375,477 V339E possibly damaging Het
Tmprss13 G T 9: 45,345,305 C516F probably damaging Het
Vmn2r69 T C 7: 85,409,809 T515A probably benign Het
Xrcc5 T C 1: 72,312,593 probably null Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zfp964 G T 8: 69,662,983 D78Y probably damaging Het
Other mutations in Olfr913
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Olfr913 APN 9 38594905 missense probably damaging 0.98
IGL02028:Olfr913 APN 9 38594419 nonsense probably null
IGL02256:Olfr913 APN 9 38594544 missense probably benign 0.01
IGL03103:Olfr913 APN 9 38594527 missense probably damaging 1.00
IGL03297:Olfr913 APN 9 38594525 missense probably benign 0.01
R2152:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R2153:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R2154:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R3176:Olfr913 UTSW 9 38594643 missense probably damaging 1.00
R3276:Olfr913 UTSW 9 38594643 missense probably damaging 1.00
R4985:Olfr913 UTSW 9 38594362 missense possibly damaging 0.88
R5043:Olfr913 UTSW 9 38594841 missense probably damaging 1.00
R5871:Olfr913 UTSW 9 38594332 missense possibly damaging 0.53
R6106:Olfr913 UTSW 9 38594956 missense probably benign 0.11
R6823:Olfr913 UTSW 9 38594905 missense possibly damaging 0.89
R7472:Olfr913 UTSW 9 38594904 missense probably benign 0.10
R7912:Olfr913 UTSW 9 38595150 missense probably benign 0.25
R8036:Olfr913 UTSW 9 38594890 missense probably benign 0.00
R8182:Olfr913 UTSW 9 38594544 missense probably benign 0.01
R8390:Olfr913 UTSW 9 38594591 nonsense probably null
Z1177:Olfr913 UTSW 9 38594289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAATCTCCTGTACCAGC -3'
(R):5'- TAAGTGTAGGCTCAGAGATATCCAG -3'

Sequencing Primer
(F):5'- GCACCTATATCAATGAGATAGAGCTG -3'
(R):5'- GGCTCAGAGATATCCAGTTTATGATG -3'
Posted On2018-06-22