Incidental Mutation 'R6583:Gdf7'
ID 524246
Institutional Source Beutler Lab
Gene Symbol Gdf7
Ensembl Gene ENSMUSG00000037660
Gene Name growth differentiation factor 7
Synonyms BMP12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock # R6583 (G1)
Quality Score 106.008
Status Not validated
Chromosome 12
Chromosomal Location 8297918-8301954 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8301758 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 59 (Q59L)
Ref Sequence ENSEMBL: ENSMUSP00000151234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037313] [ENSMUST00000220073]
AlphaFold P43029
Predicted Effect unknown
Transcript: ENSMUST00000037313
AA Change: Q59L
SMART Domains Protein: ENSMUSP00000038301
Gene: ENSMUSG00000037660
AA Change: Q59L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 49 275 2.3e-15 PFAM
low complexity region 281 302 N/A INTRINSIC
low complexity region 308 357 N/A INTRINSIC
TGFB 360 461 1.14e-63 SMART
Predicted Effect unknown
Transcript: ENSMUST00000220073
AA Change: Q59L
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in the differentiation of tendon cells and spinal cord interneurons. Mice lacking a functional copy of this gene exhibit absence of some spinal dopaminergic neurons and brain defects, male sterility, and premature death. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele lack D1A neurons in the dorsal spinal cord; some develop severe hydrocephaly with dilated ventricles and late-onset brain defects. Mice homozygous for another null allele show premature death, hydrocephaly, aberrant seminal vesicle development and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A C 3: 127,016,964 I491S probably damaging Het
Armc12 A T 17: 28,538,614 Q240L probably null Het
Cntnap5c C T 17: 58,330,277 P1050S probably damaging Het
Col4a3 C A 1: 82,641,476 A42E unknown Het
D630003M21Rik A G 2: 158,220,516 V28A probably damaging Het
Dbf4 A G 5: 8,398,143 S355P probably damaging Het
Dnah6 A G 6: 73,173,533 V749A probably benign Het
Exoc4 T C 6: 33,815,753 L606P probably damaging Het
Fggy T C 4: 95,600,973 S109P probably benign Het
M6pr T C 6: 122,313,390 V104A probably damaging Het
Macf1 A T 4: 123,470,946 probably null Het
Micu2 T C 14: 57,943,670 K169R probably damaging Het
Mthfd1l A G 10: 4,047,937 D636G probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nfib T G 4: 82,498,471 D125A probably damaging Het
Nuf2 T C 1: 169,504,548 T393A probably benign Het
Olfr913 G A 9: 38,594,964 V248I possibly damaging Het
Paox T A 7: 140,126,378 N70K probably damaging Het
Pnmal2 A G 7: 16,945,919 N276S probably damaging Het
Ralgds G A 2: 28,533,644 A32T probably damaging Het
Samd11 T A 4: 156,248,134 N446I possibly damaging Het
Soat1 T C 1: 156,466,492 probably null Het
Tmem87a A T 2: 120,375,477 V339E possibly damaging Het
Tmprss13 G T 9: 45,345,305 C516F probably damaging Het
Vmn2r69 T C 7: 85,409,809 T515A probably benign Het
Xrcc5 T C 1: 72,312,593 probably null Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zfp964 G T 8: 69,662,983 D78Y probably damaging Het
Other mutations in Gdf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02796:Gdf7 UTSW 12 8301666 missense unknown
R0781:Gdf7 UTSW 12 8301555 splice site probably benign
R1457:Gdf7 UTSW 12 8298073 missense probably damaging 0.97
R1556:Gdf7 UTSW 12 8301698 missense unknown
R1643:Gdf7 UTSW 12 8297971 missense probably damaging 1.00
R2010:Gdf7 UTSW 12 8301729 missense unknown
R2439:Gdf7 UTSW 12 8298050 missense probably damaging 1.00
R2899:Gdf7 UTSW 12 8298470 missense unknown
R3894:Gdf7 UTSW 12 8298845 missense unknown
R4854:Gdf7 UTSW 12 8298014 missense probably damaging 0.99
R5207:Gdf7 UTSW 12 8298371 missense unknown
R6199:Gdf7 UTSW 12 8298832 missense unknown
R7687:Gdf7 UTSW 12 8298257 nonsense probably null
R7745:Gdf7 UTSW 12 8301854 missense unknown
R8705:Gdf7 UTSW 12 8298167 missense probably damaging 0.96
R8845:Gdf7 UTSW 12 8298905 missense unknown
R9100:Gdf7 UTSW 12 8298652 missense unknown
Z1176:Gdf7 UTSW 12 8298409 missense unknown
Z1176:Gdf7 UTSW 12 8298578 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAAGCCGGTGATTGTGTCC -3'
(R):5'- CTATGTTCAAAAGGCGTCGGG -3'

Sequencing Primer
(F):5'- GACATCATGAAGTGGTGTG -3'
(R):5'- AAGGAGCCCATGGACCTG -3'
Posted On 2018-06-22