Mutagenetix > Incidental Mutation

Incidental Mutation 'R6583:Ywhaz'

524250

Institutional Source

Beutler Lab

Gene Symbol

Ywhaz

Ensembl Gene

ENSMUSG00000022285

Gene Name

tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide

Synonyms

1110013I11Rik, 14-3-3 zeta

MMRRC Submission

044707-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.750) question?

Stock #

R6583 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36771014-36797173 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36791166 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 19 (Y19C)

Ref Sequence

ENSEMBL: ENSMUSP00000120610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022894] [ENSMUST00000110359] [ENSMUST00000110361] [ENSMUST00000110362] [ENSMUST00000126184] [ENSMUST00000151635] [ENSMUST00000226851]

AlphaFold

P63101

Predicted Effect

probably damaging
Transcript: ENSMUST00000022894
AA Change: Y19C

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000022894
Gene: ENSMUSG00000022285
AA Change: Y19C

Domain	Start	End	E-Value	Type
14_3_3	3	242	1.25e-148	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110359
AA Change: Y19C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000110361
AA Change: Y19C

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105990
Gene: ENSMUSG00000022285
AA Change: Y19C

Domain	Start	End	E-Value	Type
14_3_3	3	242	1.25e-148	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110362
AA Change: Y19C

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105991
Gene: ENSMUSG00000022285
AA Change: Y19C

Domain	Start	End	E-Value	Type
14_3_3	3	242	1.25e-148	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126184
AA Change: Y19C

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000115928
Gene: ENSMUSG00000022285
AA Change: Y19C

Domain	Start	End	E-Value	Type
14_3_3	3	88	2.26e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000151635
AA Change: Y19C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154879

Predicted Effect

probably damaging
Transcript: ENSMUST00000226851
AA Change: Y19C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227067

Meta Mutation Damage Score

0.9353

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse, rat and sheep orthologs. The encoded protein interacts with IRS1 protein, suggesting a role in regulating insulin sensitivity. Several transcript variants that differ in the 5' UTR but that encode the same protein have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation after P14, some postnatal lethality by P21. Mice homozygous for one gene trap allele also exhibit neurodevelopmental and neuropsychiatric behaviour defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank2	A	C	3: 126,810,613 (GRCm39)	I491S	probably damaging	Het
Armc12	A	T	17: 28,757,588 (GRCm39)	Q240L	probably null	Het
Cntnap5c	C	T	17: 58,637,272 (GRCm39)	P1050S	probably damaging	Het
Col4a3	C	A	1: 82,619,197 (GRCm39)	A42E	unknown	Het
D630003M21Rik	A	G	2: 158,062,436 (GRCm39)	V28A	probably damaging	Het
Dbf4	A	G	5: 8,448,143 (GRCm39)	S355P	probably damaging	Het
Dnah6	A	G	6: 73,150,516 (GRCm39)	V749A	probably benign	Het
Exoc4	T	C	6: 33,792,688 (GRCm39)	L606P	probably damaging	Het
Fggy	T	C	4: 95,489,210 (GRCm39)	S109P	probably benign	Het
Gdf7	T	A	12: 8,351,758 (GRCm39)	Q59L	unknown	Het
M6pr	T	C	6: 122,290,349 (GRCm39)	V104A	probably damaging	Het
Macf1	A	T	4: 123,364,739 (GRCm39)		probably null	Het
Micu2	T	C	14: 58,181,127 (GRCm39)	K169R	probably damaging	Het
Mthfd1l	A	G	10: 3,997,937 (GRCm39)	D636G	probably damaging	Het
Myo1c	C	T	11: 75,562,461 (GRCm39)	P918S	probably benign	Het
Nfib	T	G	4: 82,416,708 (GRCm39)	D125A	probably damaging	Het
Nuf2	T	C	1: 169,332,117 (GRCm39)	T393A	probably benign	Het
Or8b49	G	A	9: 38,506,260 (GRCm39)	V248I	possibly damaging	Het
Paox	T	A	7: 139,706,291 (GRCm39)	N70K	probably damaging	Het
Pnma8b	A	G	7: 16,679,844 (GRCm39)	N276S	probably damaging	Het
Ralgds	G	A	2: 28,423,656 (GRCm39)	A32T	probably damaging	Het
Samd11	T	A	4: 156,332,591 (GRCm39)	N446I	possibly damaging	Het
Soat1	T	C	1: 156,294,062 (GRCm39)		probably null	Het
Tmem87a	A	T	2: 120,205,958 (GRCm39)	V339E	possibly damaging	Het
Tmprss13	G	T	9: 45,256,603 (GRCm39)	C516F	probably damaging	Het
Vmn2r69	T	C	7: 85,059,017 (GRCm39)	T515A	probably benign	Het
Xrcc5	T	C	1: 72,351,752 (GRCm39)		probably null	Het
Zfp964	G	T	8: 70,115,633 (GRCm39)	D78Y	probably damaging	Het

Other mutations in Ywhaz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Impecunious	UTSW	15	36,791,166 (GRCm39)	missense	probably damaging	1.00
R0559:Ywhaz	UTSW	15	36,791,208 (GRCm39)	missense	possibly damaging	0.80
R1291:Ywhaz	UTSW	15	36,772,978 (GRCm39)	unclassified	probably benign
R1705:Ywhaz	UTSW	15	36,790,959 (GRCm39)	missense	possibly damaging	0.55
R5810:Ywhaz	UTSW	15	36,775,510 (GRCm39)	missense	probably damaging	1.00
R6579:Ywhaz	UTSW	15	36,791,166 (GRCm39)	missense	probably damaging	1.00
R6582:Ywhaz	UTSW	15	36,791,166 (GRCm39)	missense	probably damaging	1.00
R6642:Ywhaz	UTSW	15	36,791,166 (GRCm39)	missense	probably damaging	1.00
R6643:Ywhaz	UTSW	15	36,791,166 (GRCm39)	missense	probably damaging	1.00
X0027:Ywhaz	UTSW	15	36,775,800 (GRCm39)	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- TCGTTGCAGATGTCACGCAG -3'
(R):5'- CTCAAGCTGGTTTGAGGTACTG -3'

Sequencing Primer
(F):5'- AGATGTCACGCAGCTCCGTC -3'
(R):5'- CTGGTTTGAGGTACTGGTGTGC -3'

Posted On

2018-06-22