Incidental Mutation 'R6584:Traf1'
ID524258
Institutional Source Beutler Lab
Gene Symbol Traf1
Ensembl Gene ENSMUSG00000026875
Gene NameTNF receptor-associated factor 1
Synonyms4732496E14Rik
MMRRC Submission
Accession Numbers

Genbank: NM_009421; MGI: 101836

Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location34941750-34961772 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34958058 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 8 (D8V)
Ref Sequence ENSEMBL: ENSMUSP00000144189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028234] [ENSMUST00000113064] [ENSMUST00000172159] [ENSMUST00000201690]
Predicted Effect probably damaging
Transcript: ENSMUST00000028234
AA Change: D8V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028234
Gene: ENSMUSG00000026875
AA Change: D8V

DomainStartEndE-ValueType
Pfam:TRAF_BIRC3_bd 175 238 8.4e-19 PFAM
MATH 264 386 8.29e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113064
AA Change: D8V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108687
Gene: ENSMUSG00000026875
AA Change: D8V

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
MATH 264 386 8.29e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156479
Predicted Effect probably damaging
Transcript: ENSMUST00000172159
AA Change: D8V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130759
Gene: ENSMUSG00000026875
AA Change: D8V

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
MATH 264 386 8.29e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201335
Predicted Effect probably damaging
Transcript: ENSMUST00000201690
AA Change: D8V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor (TNFR) associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from various receptors of the TNFR superfamily. This protein and TRAF2 form a heterodimeric complex, which is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF2 also interacts with inhibitor-of-apoptosis proteins (IAPs), and thus mediates the anti-apoptotic signals from TNF receptors. The expression of this protein can be induced by Epstein-Barr virus (EBV). EBV infection membrane protein 1 (LMP1) is found to interact with this and other TRAF proteins; this interaction is thought to link LMP1-mediated B lymphocyte transformation to the signal transduction from TNFR family receptors. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice exhibit abnormal T cell functionality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Traf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Traf1 APN 2 34943893 missense probably benign 0.00
IGL01993:Traf1 APN 2 34946867 splice site probably benign
IGL02429:Traf1 APN 2 34949103 missense probably benign
IGL02752:Traf1 APN 2 34958008 missense probably benign 0.00
IGL02933:Traf1 APN 2 34949095 missense possibly damaging 0.55
IGL03346:Traf1 APN 2 34948472 missense probably benign 0.01
3-1:Traf1 UTSW 2 34949106 critical splice acceptor site probably null
R0220:Traf1 UTSW 2 34949103 missense probably benign
R2064:Traf1 UTSW 2 34948190 missense probably benign 0.07
R4458:Traf1 UTSW 2 34945433 missense probably damaging 1.00
R4797:Traf1 UTSW 2 34956277 missense probably benign 0.17
R5398:Traf1 UTSW 2 34945435 missense probably damaging 1.00
R6221:Traf1 UTSW 2 34948301 missense probably benign 0.45
R6792:Traf1 UTSW 2 34956275 missense probably benign 0.00
R7350:Traf1 UTSW 2 34948233 missense probably benign 0.11
Z1177:Traf1 UTSW 2 34945435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCATGGGCAGTATTCAG -3'
(R):5'- GACTCAGCTATGACGTCGTAC -3'

Sequencing Primer
(F):5'- GGTGAAGTTATCTGCTCACAGTCAC -3'
(R):5'- GCTATGACGTCGTACCACAC -3'
Posted On2018-06-22