Incidental Mutation 'R6584:Slitrk3'
ID524262
Institutional Source Beutler Lab
Gene Symbol Slitrk3
Ensembl Gene ENSMUSG00000048304
Gene NameSLIT and NTRK-like family, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location73047265-73057803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73049225 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 738 (G738V)
Ref Sequence ENSEMBL: ENSMUSP00000141236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]
Predicted Effect probably damaging
Transcript: ENSMUST00000059407
AA Change: G738V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: G738V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000192477
AA Change: G738V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: G738V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Slitrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slitrk3 APN 3 73051103 missense probably damaging 1.00
IGL00857:Slitrk3 APN 3 73049841 missense probably damaging 1.00
IGL00990:Slitrk3 APN 3 73050081 missense probably damaging 1.00
IGL01010:Slitrk3 APN 3 73049273 missense probably benign 0.14
IGL01299:Slitrk3 APN 3 73049016 missense probably benign 0.43
IGL01609:Slitrk3 APN 3 73050237 missense probably damaging 1.00
IGL01881:Slitrk3 APN 3 73049306 missense probably benign 0.00
IGL01941:Slitrk3 APN 3 73051071 missense possibly damaging 0.72
IGL02183:Slitrk3 APN 3 73049979 missense probably damaging 0.97
IGL02187:Slitrk3 APN 3 73050272 missense probably damaging 1.00
IGL02478:Slitrk3 APN 3 73050713 missense probably damaging 0.96
IGL02512:Slitrk3 APN 3 73050402 missense probably benign 0.28
IGL02720:Slitrk3 APN 3 73050768 missense probably damaging 1.00
IGL03113:Slitrk3 APN 3 73050390 missense probably benign 0.00
IGL03224:Slitrk3 APN 3 73049930 missense possibly damaging 0.72
wee UTSW 3 73050785 missense probably damaging 1.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0639:Slitrk3 UTSW 3 73049649 missense probably benign 0.02
R1448:Slitrk3 UTSW 3 73050341 missense probably damaging 0.99
R1656:Slitrk3 UTSW 3 73050339 missense probably damaging 0.98
R1713:Slitrk3 UTSW 3 73049691 missense probably benign 0.00
R1992:Slitrk3 UTSW 3 73049771 missense possibly damaging 0.80
R1999:Slitrk3 UTSW 3 73049964 missense probably benign 0.13
R2359:Slitrk3 UTSW 3 73049345 missense possibly damaging 0.56
R3083:Slitrk3 UTSW 3 73048595 missense probably benign 0.00
R3153:Slitrk3 UTSW 3 73048982 nonsense probably null
R3821:Slitrk3 UTSW 3 73049216 missense possibly damaging 0.94
R4208:Slitrk3 UTSW 3 73051157 missense possibly damaging 0.67
R4323:Slitrk3 UTSW 3 73050785 missense probably damaging 1.00
R4580:Slitrk3 UTSW 3 73051206 missense probably damaging 0.96
R4730:Slitrk3 UTSW 3 73049519 missense probably benign 0.08
R4742:Slitrk3 UTSW 3 73048565 missense probably benign 0.00
R4979:Slitrk3 UTSW 3 73049796 missense possibly damaging 0.95
R5018:Slitrk3 UTSW 3 73050512 missense probably benign 0.31
R5023:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5057:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5156:Slitrk3 UTSW 3 73049259 missense probably benign
R5500:Slitrk3 UTSW 3 73050347 missense probably damaging 1.00
R5582:Slitrk3 UTSW 3 73050404 missense probably benign 0.09
R5797:Slitrk3 UTSW 3 73048629 missense probably damaging 0.99
R5963:Slitrk3 UTSW 3 73050713 missense probably benign 0.30
R5985:Slitrk3 UTSW 3 73050900 missense probably damaging 1.00
R6123:Slitrk3 UTSW 3 73049762 missense probably damaging 1.00
R6393:Slitrk3 UTSW 3 73049914 missense possibly damaging 0.79
R6529:Slitrk3 UTSW 3 73051218 missense probably benign 0.02
R6645:Slitrk3 UTSW 3 73049861 missense probably benign 0.13
R7001:Slitrk3 UTSW 3 73050609 nonsense probably null
R7282:Slitrk3 UTSW 3 73050465 missense possibly damaging 0.70
R7534:Slitrk3 UTSW 3 73050107 missense probably damaging 0.98
R7577:Slitrk3 UTSW 3 73051115 missense probably damaging 0.99
R7757:Slitrk3 UTSW 3 73050839 missense probably damaging 1.00
R8251:Slitrk3 UTSW 3 73049396 missense possibly damaging 0.67
X0022:Slitrk3 UTSW 3 73050266 missense probably damaging 1.00
Z1176:Slitrk3 UTSW 3 73048770 missense probably benign 0.09
Z1177:Slitrk3 UTSW 3 73049142 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCAGCAAGGTCCTGTAGTTAC -3'
(R):5'- TCGGCGTAGGAAGAAGTTGC -3'

Sequencing Primer
(F):5'- GGGTGTTTCTGCAAACTGCTCAC -3'
(R):5'- TTGCCCTTTAGAAGCAAGAGAC -3'
Posted On2018-06-22