Incidental Mutation 'R6584:Wdr49'
ID524264
Institutional Source Beutler Lab
Gene Symbol Wdr49
Ensembl Gene ENSMUSG00000104301
Gene NameWD repeat domain 49
SynonymsEG213248
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location75274988-75482156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75337758 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 339 (M339V)
Ref Sequence ENSEMBL: ENSMUSP00000144721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000193989]
Predicted Effect probably benign
Transcript: ENSMUST00000193989
AA Change: M339V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144721
Gene: ENSMUSG00000104301
AA Change: M339V

DomainStartEndE-ValueType
WD40 17 55 1.3e-2 SMART
WD40 59 98 2e-6 SMART
WD40 145 184 2.5e-2 SMART
WD40 187 228 3.6e-8 SMART
WD40 281 318 8.7e-6 SMART
WD40 365 412 2.2e-1 SMART
WD40 415 455 8.4e-4 SMART
WD40 471 512 3.1e-2 SMART
Blast:SERPIN 608 673 7e-12 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family with nine WD repeats. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Other mutations in Wdr49
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0266:Wdr49 UTSW 3 75451796 missense possibly damaging 0.80
R0432:Wdr49 UTSW 3 75450022 missense possibly damaging 0.70
R0599:Wdr49 UTSW 3 75431076 splice site probably null
R0599:Wdr49 UTSW 3 75449890 splice site probably null
R0948:Wdr49 UTSW 3 75450851 missense probably benign 0.06
R1341:Wdr49 UTSW 3 75429333 missense probably damaging 1.00
R1526:Wdr49 UTSW 3 75396920 missense probably benign 0.03
R1593:Wdr49 UTSW 3 75396941 missense probably benign 0.00
R1603:Wdr49 UTSW 3 75396870 nonsense probably null
R1874:Wdr49 UTSW 3 75429347 missense probably damaging 1.00
R2986:Wdr49 UTSW 3 75382040 missense probably benign 0.11
R3013:Wdr49 UTSW 3 75450847 missense probably damaging 0.96
R3025:Wdr49 UTSW 3 75333356 missense possibly damaging 0.94
R4027:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4029:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4030:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4031:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4578:Wdr49 UTSW 3 75335243 missense probably benign 0.00
R6024:Wdr49 UTSW 3 75301826 missense probably benign 0.02
R6141:Wdr49 UTSW 3 75323682 missense probably benign
R6172:Wdr49 UTSW 3 75298180 missense probably damaging 1.00
R6263:Wdr49 UTSW 3 75481517 missense possibly damaging 0.84
R6501:Wdr49 UTSW 3 75339458 missense probably benign 0.01
R6698:Wdr49 UTSW 3 75429366 missense probably benign 0.01
R6891:Wdr49 UTSW 3 75333283 synonymous probably null
R7202:Wdr49 UTSW 3 75333273 missense probably benign 0.11
R7214:Wdr49 UTSW 3 75358444 missense possibly damaging 0.63
R7572:Wdr49 UTSW 3 75358437 missense possibly damaging 0.94
R7575:Wdr49 UTSW 3 75450886 missense probably damaging 0.96
R7673:Wdr49 UTSW 3 75450907 missense probably damaging 1.00
R7790:Wdr49 UTSW 3 75275028 missense probably benign 0.16
Z1176:Wdr49 UTSW 3 75451533 missense probably damaging 1.00
Z1177:Wdr49 UTSW 3 75449903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATGATCCTCTCAATCACTGTG -3'
(R):5'- AGCTATCCACCAAATATGTGGGTTAC -3'

Sequencing Primer
(F):5'- GATCCTCTCAATCACTGTGATAAGC -3'
(R):5'- TGCTTCCAAAATTAGAGAAAACCTAC -3'
Posted On2018-06-22