Incidental Mutation 'R6584:Gm13088'
ID524271
Institutional Source Beutler Lab
Gene Symbol Gm13088
Ensembl Gene ENSMUSG00000078513
Gene Namepredicted gene 13088
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location143653760-143657246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143655470 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 219 (T219S)
Ref Sequence ENSEMBL: ENSMUSP00000101397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105771]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105771
AA Change: T219S

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101397
Gene: ENSMUSG00000078513
AA Change: T219S

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
low complexity region 372 391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Gm13088
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Gm13088 APN 4 143655317 missense probably benign 0.00
IGL01418:Gm13088 APN 4 143655317 missense probably benign 0.00
IGL01551:Gm13088 APN 4 143656472 missense probably damaging 0.99
IGL02016:Gm13088 APN 4 143655319 missense possibly damaging 0.52
IGL02157:Gm13088 APN 4 143654377 missense probably damaging 1.00
IGL02433:Gm13088 APN 4 143655437 missense possibly damaging 0.92
IGL02726:Gm13088 APN 4 143655385 missense probably damaging 1.00
IGL02900:Gm13088 APN 4 143655515 missense possibly damaging 0.59
IGL03367:Gm13088 APN 4 143655623 missense possibly damaging 0.46
IGL02835:Gm13088 UTSW 4 143654247 missense probably damaging 1.00
R0141:Gm13088 UTSW 4 143654568 missense probably benign 0.01
R0166:Gm13088 UTSW 4 143654511 missense probably benign 0.00
R0197:Gm13088 UTSW 4 143656440 missense possibly damaging 0.76
R0365:Gm13088 UTSW 4 143655501 nonsense probably null
R0427:Gm13088 UTSW 4 143654423 missense probably benign 0.00
R0701:Gm13088 UTSW 4 143656440 missense possibly damaging 0.76
R0927:Gm13088 UTSW 4 143654220 missense possibly damaging 0.84
R1103:Gm13088 UTSW 4 143655372 missense probably damaging 1.00
R1163:Gm13088 UTSW 4 143656634 missense probably damaging 1.00
R1565:Gm13088 UTSW 4 143655617 nonsense probably null
R1588:Gm13088 UTSW 4 143655551 missense probably damaging 1.00
R1669:Gm13088 UTSW 4 143654346 missense possibly damaging 0.53
R1925:Gm13088 UTSW 4 143654455 missense probably damaging 1.00
R1929:Gm13088 UTSW 4 143654142 missense probably damaging 1.00
R1990:Gm13088 UTSW 4 143654268 missense probably damaging 1.00
R2272:Gm13088 UTSW 4 143654142 missense probably damaging 1.00
R2845:Gm13088 UTSW 4 143654298 missense probably damaging 0.99
R3819:Gm13088 UTSW 4 143655795 missense probably benign 0.02
R4660:Gm13088 UTSW 4 143654277 missense probably benign 0.01
R4857:Gm13088 UTSW 4 143656588 missense possibly damaging 0.65
R4888:Gm13088 UTSW 4 143654401 missense probably benign 0.33
R5004:Gm13088 UTSW 4 143654136 missense probably benign
R5242:Gm13088 UTSW 4 143655611 missense probably benign 0.38
R5246:Gm13088 UTSW 4 143655557 missense probably benign 0.00
R5596:Gm13088 UTSW 4 143654455 missense probably damaging 1.00
R5735:Gm13088 UTSW 4 143654635 missense probably damaging 1.00
R5841:Gm13088 UTSW 4 143655539 missense possibly damaging 0.95
R5982:Gm13088 UTSW 4 143654464 missense probably damaging 0.99
R6052:Gm13088 UTSW 4 143655652 missense probably damaging 1.00
R6169:Gm13088 UTSW 4 143654115 missense probably benign 0.04
R6403:Gm13088 UTSW 4 143655773 nonsense probably null
R6898:Gm13088 UTSW 4 143655483 missense probably damaging 1.00
R7438:Gm13088 UTSW 4 143655560 missense probably damaging 0.96
R7563:Gm13088 UTSW 4 143654105 nonsense probably null
X0021:Gm13088 UTSW 4 143655748 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGAGTATGACATGACCCC -3'
(R):5'- TTGGAGTGGACCCAGCAAAG -3'

Sequencing Primer
(F):5'- GGAGTATGACATGACCCCCTCAG -3'
(R):5'- TTCCATTCATCTATTCTGTAGGAAGC -3'
Posted On2018-06-22