Incidental Mutation 'R6619:Reep1'
ID524274
Institutional Source Beutler Lab
Gene Symbol Reep1
Ensembl Gene ENSMUSG00000052852
Gene Namereceptor accessory protein 1
SynonymsD6Ertd253e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6619 (G1)
Quality Score158.009
Status Validated
Chromosome6
Chromosomal Location71707561-71810710 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 71807842 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121469] [ENSMUST00000212631] [ENSMUST00000212792]
Predicted Effect probably benign
Transcript: ENSMUST00000121469
SMART Domains Protein: ENSMUSP00000112662
Gene: ENSMUSG00000052852

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 7 95 1.1e-35 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205395
Predicted Effect unknown
Transcript: ENSMUST00000212631
AA Change: S138P
Predicted Effect unknown
Transcript: ENSMUST00000212792
AA Change: S279P
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spastic paraplegia in aged mice with reduced ER complexity in cortical motor neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 G A 16: 29,349,015 P109S probably benign Het
Baiap2l1 T C 5: 144,286,106 K106R probably benign Het
Coro6 A G 11: 77,466,204 I111V possibly damaging Het
Crocc2 A G 1: 93,190,501 E382G probably benign Het
Dnah5 C A 15: 28,409,120 N3561K probably benign Het
Dsc2 T A 18: 20,032,278 E879D probably benign Het
Frk A G 10: 34,605,839 Y375C probably benign Het
Gm4756 A T 12: 72,621,950 N44K possibly damaging Het
Herc2 A T 7: 56,068,092 R61* probably null Het
Jarid2 A G 13: 44,874,396 D146G probably damaging Het
Lancl2 C A 6: 57,722,581 T127K probably damaging Het
Large1 G A 8: 72,883,264 Q359* probably null Het
Mast2 C A 4: 116,316,497 E521* probably null Het
Mrc1 T A 2: 14,294,786 probably null Het
Olfr1085 T C 2: 86,658,062 Y132C probably damaging Het
Olfr1427 A G 19: 12,099,363 I92T probably damaging Het
Olfr768 A T 10: 129,093,454 D173E possibly damaging Het
Olfr993 T C 2: 85,414,081 N266S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
P2ry14 T C 3: 59,115,733 Y102C probably damaging Het
Pcdhga6 T A 18: 37,709,649 D807E probably benign Het
Pcdhgb4 T A 18: 37,721,684 N377K probably damaging Het
Phf13 T A 4: 151,991,657 N263Y probably damaging Het
Rab19 T A 6: 39,388,126 S107T probably damaging Het
Rasgrf2 A T 13: 92,028,519 F380I probably damaging Het
Rnf219 T C 14: 104,522,557 H19R possibly damaging Het
Rpgrip1l C T 8: 91,232,871 E1134K possibly damaging Het
Serpina3m A T 12: 104,391,507 Y230F probably benign Het
Skint3 T C 4: 112,253,864 I62T probably damaging Het
Smg6 T C 11: 74,932,453 probably null Het
Sp4 G A 12: 118,299,342 T323I possibly damaging Het
Strc A G 2: 121,368,432 I1378T probably damaging Het
Tepsin C T 11: 120,095,602 G128D probably benign Het
Togaram2 A G 17: 71,689,271 N89D probably damaging Het
Trim36 T C 18: 46,188,408 T191A probably damaging Het
Trp53bp1 A T 2: 121,247,499 probably null Het
Zfp418 G A 7: 7,181,896 C286Y probably damaging Het
Other mutations in Reep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Reep1 APN 6 71773288 missense probably damaging 1.00
IGL03057:Reep1 APN 6 71807781 splice site probably benign
R1596:Reep1 UTSW 6 71756437 critical splice donor site probably null
R1899:Reep1 UTSW 6 71780797 missense probably benign 0.32
R2201:Reep1 UTSW 6 71773294 missense probably damaging 1.00
R2252:Reep1 UTSW 6 71756442 splice site probably null
R3787:Reep1 UTSW 6 71795215 missense probably damaging 0.98
R4760:Reep1 UTSW 6 71708001 missense possibly damaging 0.67
R5657:Reep1 UTSW 6 71761374 missense possibly damaging 0.89
R6659:Reep1 UTSW 6 71773195 missense probably damaging 1.00
R7080:Reep1 UTSW 6 71780765 missense possibly damaging 0.81
R7299:Reep1 UTSW 6 71761389 missense probably benign 0.02
R7730:Reep1 UTSW 6 71780741 missense possibly damaging 0.64
RF019:Reep1 UTSW 6 71707969 start codon destroyed probably null
RF023:Reep1 UTSW 6 71707968 start codon destroyed probably null
RF029:Reep1 UTSW 6 71707966 start codon destroyed probably null
RF032:Reep1 UTSW 6 71707968 start codon destroyed probably null
RF042:Reep1 UTSW 6 71707966 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GTGCAACGCTAGAATCTGATTCC -3'
(R):5'- AGACGTAAAGGTCACCCTCC -3'

Sequencing Primer
(F):5'- GCAACGCTAGAATCTGATTCCTGTTG -3'
(R):5'- TTAGCCTCTCCCCAGCAGG -3'
Posted On2018-06-22