Incidental Mutation 'R6584:Vmn2r24'
ID524277
Institutional Source Beutler Lab
Gene Symbol Vmn2r24
Ensembl Gene ENSMUSG00000072780
Gene Namevomeronasal 2, receptor 24
SynonymsEG243628
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location123778971-123816280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 123815805 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 697 (M697R)
Ref Sequence ENSEMBL: ENSMUSP00000074602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075095
AA Change: M697R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074602
Gene: ENSMUSG00000072780
AA Change: M697R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 469 1.6e-32 PFAM
Pfam:NCD3G 518 571 1.1e-22 PFAM
Pfam:7tm_3 602 839 1.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Vmn2r24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r24 APN 6 123815637 missense probably damaging 1.00
IGL01382:Vmn2r24 APN 6 123786979 missense possibly damaging 0.62
IGL01592:Vmn2r24 APN 6 123787486 missense probably benign 0.30
IGL01754:Vmn2r24 APN 6 123804161 missense probably damaging 1.00
IGL01939:Vmn2r24 APN 6 123787445 missense probably benign
IGL02140:Vmn2r24 APN 6 123780672 missense probably damaging 0.98
IGL02272:Vmn2r24 APN 6 123786884 missense possibly damaging 0.94
IGL02568:Vmn2r24 APN 6 123815853 missense probably benign 0.36
IGL02748:Vmn2r24 APN 6 123816098 missense possibly damaging 0.90
IGL03022:Vmn2r24 APN 6 123779008 missense probably damaging 0.99
IGL03343:Vmn2r24 APN 6 123816111 missense probably damaging 1.00
R0357:Vmn2r24 UTSW 6 123815410 frame shift probably null
R0453:Vmn2r24 UTSW 6 123780391 critical splice acceptor site probably null
R0538:Vmn2r24 UTSW 6 123816053 missense probably benign 0.32
R0607:Vmn2r24 UTSW 6 123786934 missense probably benign
R1381:Vmn2r24 UTSW 6 123786733 missense probably damaging 1.00
R1589:Vmn2r24 UTSW 6 123806520 splice site probably benign
R1848:Vmn2r24 UTSW 6 123816224 missense probably damaging 1.00
R2035:Vmn2r24 UTSW 6 123816060 missense probably damaging 1.00
R2077:Vmn2r24 UTSW 6 123815399 missense probably damaging 1.00
R2122:Vmn2r24 UTSW 6 123815394 missense possibly damaging 0.81
R2145:Vmn2r24 UTSW 6 123779013 missense probably benign
R2483:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R2512:Vmn2r24 UTSW 6 123787026 missense probably benign 0.01
R3001:Vmn2r24 UTSW 6 123804272 missense probably benign 0.00
R3002:Vmn2r24 UTSW 6 123804272 missense probably benign 0.00
R3236:Vmn2r24 UTSW 6 123779025 nonsense probably null
R3623:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R3624:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R3835:Vmn2r24 UTSW 6 123787453 missense probably benign 0.33
R4074:Vmn2r24 UTSW 6 123787415 missense possibly damaging 0.92
R4075:Vmn2r24 UTSW 6 123787415 missense possibly damaging 0.92
R4812:Vmn2r24 UTSW 6 123779185 missense probably benign 0.00
R4825:Vmn2r24 UTSW 6 123815780 missense probably benign 0.02
R5351:Vmn2r24 UTSW 6 123816264 missense possibly damaging 0.80
R5665:Vmn2r24 UTSW 6 123786979 missense possibly damaging 0.62
R5790:Vmn2r24 UTSW 6 123815540 missense probably benign
R5808:Vmn2r24 UTSW 6 123815638 nonsense probably null
R5879:Vmn2r24 UTSW 6 123787267 missense possibly damaging 0.89
R5923:Vmn2r24 UTSW 6 123815792 missense probably damaging 0.96
R5969:Vmn2r24 UTSW 6 123779022 missense probably benign 0.00
R6050:Vmn2r24 UTSW 6 123815732 missense probably damaging 1.00
R6171:Vmn2r24 UTSW 6 123787246 missense probably damaging 0.98
R6174:Vmn2r24 UTSW 6 123816277 missense probably benign 0.00
R6356:Vmn2r24 UTSW 6 123806409 missense possibly damaging 0.93
R6562:Vmn2r24 UTSW 6 123780427 missense probably benign 0.01
R6563:Vmn2r24 UTSW 6 123804178 missense possibly damaging 0.86
R6630:Vmn2r24 UTSW 6 123787022 missense probably benign 0.00
R6803:Vmn2r24 UTSW 6 123779001 missense possibly damaging 0.64
R6864:Vmn2r24 UTSW 6 123779158 missense possibly damaging 0.89
R7252:Vmn2r24 UTSW 6 123787232 missense possibly damaging 0.90
R7369:Vmn2r24 UTSW 6 123815679 missense probably damaging 0.99
R7646:Vmn2r24 UTSW 6 123816210 missense probably benign 0.20
R7799:Vmn2r24 UTSW 6 123780463 missense probably benign 0.00
R7803:Vmn2r24 UTSW 6 123780479 missense probably benign 0.00
RF006:Vmn2r24 UTSW 6 123806419 missense probably damaging 1.00
RF016:Vmn2r24 UTSW 6 123804215 missense probably benign 0.04
X0023:Vmn2r24 UTSW 6 123787400 missense probably damaging 0.99
Z1088:Vmn2r24 UTSW 6 123804196 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGAAATCTCAGTTATCTCCTCC -3'
(R):5'- TAAGCAAGCTGAGACTGGCC -3'

Sequencing Primer
(F):5'- TCTCAGTTATCTCCTCCTAATTTCTC -3'
(R):5'- CTGAGACTGGCCAGAAAGC -3'
Posted On2018-06-22