Incidental Mutation 'R6584:Tbc1d9'
ID524280
Institutional Source Beutler Lab
Gene Symbol Tbc1d9
Ensembl Gene ENSMUSG00000031709
Gene NameTBC1 domain family, member 9
Synonyms4933431N12Rik, C76116
MMRRC Submission
Accession Numbers

Genbank: NM_001111304.1, NM_027758.4

Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83165352-83272934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83261000 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 863 (Q863K)
Ref Sequence ENSEMBL: ENSMUSP00000091093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034145] [ENSMUST00000093393]
Predicted Effect unknown
Transcript: ENSMUST00000034145
AA Change: Q630K
SMART Domains Protein: ENSMUSP00000034145
Gene: ENSMUSG00000031709
AA Change: Q630K

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
low complexity region 192 208 N/A INTRINSIC
TBC 279 492 8.68e-56 SMART
Blast:TBC 500 587 5e-35 BLAST
PDB:1BJF|B 579 703 3e-7 PDB
low complexity region 917 937 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093393
AA Change: Q863K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091093
Gene: ENSMUSG00000031709
AA Change: Q863K

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
GRAM 146 213 1.2e-25 SMART
low complexity region 267 278 N/A INTRINSIC
GRAM 293 361 1.37e-20 SMART
low complexity region 425 441 N/A INTRINSIC
TBC 512 725 8.68e-56 SMART
Blast:TBC 733 820 6e-35 BLAST
PDB:1BJF|B 812 936 4e-7 PDB
low complexity region 1150 1170 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142673
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Tbc1d9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tbc1d9 APN 8 83234162 missense probably damaging 1.00
IGL01443:Tbc1d9 APN 8 83239931 missense probably damaging 1.00
IGL01536:Tbc1d9 APN 8 83260992 missense probably damaging 1.00
IGL01811:Tbc1d9 APN 8 83233678 missense probably damaging 1.00
IGL02068:Tbc1d9 APN 8 83239868 missense probably damaging 1.00
IGL02938:Tbc1d9 APN 8 83269067 splice site probably benign
IGL02995:Tbc1d9 APN 8 83269059 critical splice donor site probably null
IGL03127:Tbc1d9 APN 8 83249473 missense probably damaging 1.00
IGL03128:Tbc1d9 APN 8 83166085 missense probably benign 0.01
H9600:Tbc1d9 UTSW 8 83210461 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0112:Tbc1d9 UTSW 8 83264837 splice site probably benign
R0525:Tbc1d9 UTSW 8 83268985 missense probably benign 0.08
R0528:Tbc1d9 UTSW 8 83210456 missense probably damaging 1.00
R0737:Tbc1d9 UTSW 8 83259313 missense probably damaging 1.00
R1144:Tbc1d9 UTSW 8 83236571 missense possibly damaging 0.93
R1354:Tbc1d9 UTSW 8 83268981 critical splice acceptor site probably null
R1551:Tbc1d9 UTSW 8 83266158 missense probably benign 0.03
R1620:Tbc1d9 UTSW 8 83249595 missense probably damaging 1.00
R1971:Tbc1d9 UTSW 8 83249510 missense probably damaging 1.00
R1990:Tbc1d9 UTSW 8 83271303 missense probably damaging 1.00
R2082:Tbc1d9 UTSW 8 83270987 missense probably damaging 1.00
R2149:Tbc1d9 UTSW 8 83271449 missense probably damaging 1.00
R2442:Tbc1d9 UTSW 8 83166076 start codon destroyed probably null 0.08
R2920:Tbc1d9 UTSW 8 83210469 missense probably benign 0.00
R3832:Tbc1d9 UTSW 8 83233663 missense probably damaging 1.00
R3953:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3955:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3956:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3957:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R4117:Tbc1d9 UTSW 8 83266147 missense possibly damaging 0.93
R4467:Tbc1d9 UTSW 8 83210478 missense probably damaging 1.00
R4533:Tbc1d9 UTSW 8 83270918 missense probably damaging 1.00
R4568:Tbc1d9 UTSW 8 83271177 missense probably benign 0.00
R4694:Tbc1d9 UTSW 8 83234246 missense probably damaging 1.00
R4804:Tbc1d9 UTSW 8 83255925 critical splice donor site probably null
R5056:Tbc1d9 UTSW 8 83269206 missense probably benign
R5073:Tbc1d9 UTSW 8 83233547 missense probably damaging 1.00
R5122:Tbc1d9 UTSW 8 83236543 missense probably damaging 0.98
R5270:Tbc1d9 UTSW 8 83233654 missense probably benign
R5618:Tbc1d9 UTSW 8 83242592 missense probably damaging 1.00
R5738:Tbc1d9 UTSW 8 83271026 missense probably benign
R5793:Tbc1d9 UTSW 8 83271440 missense probably damaging 0.96
R5908:Tbc1d9 UTSW 8 83249545 missense probably benign 0.05
R6258:Tbc1d9 UTSW 8 83210516 missense probably damaging 1.00
R6888:Tbc1d9 UTSW 8 83271588 missense possibly damaging 0.92
R6897:Tbc1d9 UTSW 8 83166180 missense probably damaging 1.00
R6969:Tbc1d9 UTSW 8 83241542 missense probably damaging 0.99
R7026:Tbc1d9 UTSW 8 83241563 missense probably benign 0.06
R7072:Tbc1d9 UTSW 8 83264865 missense probably damaging 0.97
R7099:Tbc1d9 UTSW 8 83254891 missense probably damaging 1.00
R7138:Tbc1d9 UTSW 8 83210484 missense probably damaging 1.00
R7172:Tbc1d9 UTSW 8 83254761 missense probably damaging 0.96
R7267:Tbc1d9 UTSW 8 83271328 missense probably damaging 1.00
R7371:Tbc1d9 UTSW 8 83271261 missense probably damaging 0.96
R7457:Tbc1d9 UTSW 8 83236680 missense probably damaging 0.99
R7552:Tbc1d9 UTSW 8 83239931 missense probably damaging 1.00
R7645:Tbc1d9 UTSW 8 83242553 missense probably damaging 1.00
R7728:Tbc1d9 UTSW 8 83259350 missense probably damaging 0.99
R7804:Tbc1d9 UTSW 8 83236712 missense possibly damaging 0.85
R8150:Tbc1d9 UTSW 8 83255890 missense probably damaging 1.00
X0062:Tbc1d9 UTSW 8 83233702 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGGCAGATTGGACACTGTG -3'
(R):5'- TGAGTGCTATCGAGGGGAAC -3'

Sequencing Primer
(F):5'- CAGATTGGACACTGTGCCTAG -3'
(R):5'- AGGTGACACCCCCATTGTC -3'
Posted On2018-06-22