Incidental Mutation 'R6619:Large1'
ID 524281
Institutional Source Beutler Lab
Gene Symbol Large1
Ensembl Gene ENSMUSG00000004383
Gene Name LARGE xylosyl- and glucuronyltransferase 1
Synonyms froggy, BPFD#36, fg, enr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock # R6619 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 72814599-73353540 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 72883264 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 359 (Q359*)
Ref Sequence ENSEMBL: ENSMUSP00000148336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]
AlphaFold Q9Z1M7
Predicted Effect probably null
Transcript: ENSMUST00000004497
AA Change: Q359*
SMART Domains Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: Q359*

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 141 387 6.2e-22 PFAM
Pfam:Glyco_transf_49 473 540 5.2e-15 PFAM
Pfam:Glyco_transf_49 535 743 1.1e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119826
AA Change: Q359*
SMART Domains Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: Q359*

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 142 386 3e-23 PFAM
Pfam:Glyco_transf_49 473 540 2.3e-11 PFAM
Pfam:Glyco_transf_49 520 743 2.7e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212459
AA Change: Q359*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 G A 16: 29,349,015 P109S probably benign Het
Baiap2l1 T C 5: 144,286,106 K106R probably benign Het
Coro6 A G 11: 77,466,204 I111V possibly damaging Het
Crocc2 A G 1: 93,190,501 E382G probably benign Het
Dnah5 C A 15: 28,409,120 N3561K probably benign Het
Dsc2 T A 18: 20,032,278 E879D probably benign Het
Frk A G 10: 34,605,839 Y375C probably benign Het
Gm4756 A T 12: 72,621,950 N44K possibly damaging Het
Herc2 A T 7: 56,068,092 R61* probably null Het
Jarid2 A G 13: 44,874,396 D146G probably damaging Het
Lancl2 C A 6: 57,722,581 T127K probably damaging Het
Mast2 C A 4: 116,316,497 E521* probably null Het
Mrc1 T A 2: 14,294,786 probably null Het
Olfr1085 T C 2: 86,658,062 Y132C probably damaging Het
Olfr1427 A G 19: 12,099,363 I92T probably damaging Het
Olfr768 A T 10: 129,093,454 D173E possibly damaging Het
Olfr993 T C 2: 85,414,081 N266S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
P2ry14 T C 3: 59,115,733 Y102C probably damaging Het
Pcdhga6 T A 18: 37,709,649 D807E probably benign Het
Pcdhgb4 T A 18: 37,721,684 N377K probably damaging Het
Phf13 T A 4: 151,991,657 N263Y probably damaging Het
Rab19 T A 6: 39,388,126 S107T probably damaging Het
Rasgrf2 A T 13: 92,028,519 F380I probably damaging Het
Reep1 T C 6: 71,807,842 probably benign Het
Rnf219 T C 14: 104,522,557 H19R possibly damaging Het
Rpgrip1l C T 8: 91,232,871 E1134K possibly damaging Het
Serpina3m A T 12: 104,391,507 Y230F probably benign Het
Skint3 T C 4: 112,253,864 I62T probably damaging Het
Smg6 T C 11: 74,932,453 probably null Het
Sp4 G A 12: 118,299,342 T323I possibly damaging Het
Strc A G 2: 121,368,432 I1378T probably damaging Het
Tepsin C T 11: 120,095,602 G128D probably benign Het
Togaram2 A G 17: 71,689,271 N89D probably damaging Het
Trim36 T C 18: 46,188,408 T191A probably damaging Het
Trp53bp1 A T 2: 121,247,499 probably null Het
Zfp418 G A 7: 7,181,896 C286Y probably damaging Het
Other mutations in Large1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Large1 APN 8 72837497 missense probably damaging 1.00
IGL00326:Large1 APN 8 73131983 missense probably benign
IGL00418:Large1 APN 8 72823841 critical splice acceptor site probably null
IGL01155:Large1 APN 8 73131989 missense probably benign 0.01
IGL01793:Large1 APN 8 72859181 splice site probably benign
IGL01929:Large1 APN 8 72859275 missense probably damaging 1.00
IGL02218:Large1 APN 8 72912122 missense probably damaging 1.00
IGL02276:Large1 APN 8 72818093 missense probably benign 0.00
IGL02329:Large1 APN 8 73048317 missense possibly damaging 0.80
IGL02543:Large1 APN 8 73048414 missense probably benign 0.00
IGL02887:Large1 APN 8 73132039 missense probably benign 0.07
biggs UTSW 8 73116419 missense probably damaging 1.00
umber UTSW 8 72883264 nonsense probably null
R0179:Large1 UTSW 8 73098846 missense probably benign 0.09
R0477:Large1 UTSW 8 72818082 missense probably damaging 1.00
R0587:Large1 UTSW 8 72859333 missense probably damaging 1.00
R0791:Large1 UTSW 8 73048479 splice site probably benign
R1253:Large1 UTSW 8 73048422 missense probably damaging 0.98
R1695:Large1 UTSW 8 72818082 missense probably damaging 1.00
R2017:Large1 UTSW 8 72852197 missense probably damaging 1.00
R4835:Large1 UTSW 8 73048347 missense probably damaging 1.00
R5105:Large1 UTSW 8 72852244 nonsense probably null
R5120:Large1 UTSW 8 72859341 missense probably damaging 1.00
R5135:Large1 UTSW 8 72818096 missense probably benign 0.38
R5137:Large1 UTSW 8 73048309 missense possibly damaging 0.58
R5567:Large1 UTSW 8 72837453 missense possibly damaging 0.93
R5945:Large1 UTSW 8 72852200 missense probably damaging 0.99
R6951:Large1 UTSW 8 73116419 missense probably damaging 1.00
R7041:Large1 UTSW 8 73116464 missense probably damaging 0.98
R7300:Large1 UTSW 8 72837596 missense probably damaging 1.00
R7493:Large1 UTSW 8 72823715 missense probably benign 0.23
R7877:Large1 UTSW 8 73116443 missense probably damaging 1.00
R8118:Large1 UTSW 8 73131944 missense probably benign 0.40
R8129:Large1 UTSW 8 72815957 missense probably damaging 1.00
R8525:Large1 UTSW 8 72837492 missense probably damaging 1.00
R8963:Large1 UTSW 8 72815984 missense probably damaging 1.00
R9170:Large1 UTSW 8 72816017 missense probably benign 0.00
Z1088:Large1 UTSW 8 72912103 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGGCTCAAGGACAACTG -3'
(R):5'- ATAAGCACCAAGTCGCCTAGG -3'

Sequencing Primer
(F):5'- GGCTCAAGGACAACTGTTTCCAG -3'
(R):5'- AGGTTGGCCTGTGACATTCCC -3'
Posted On 2018-06-22