Incidental Mutation 'R6584:Clgn'
ID524282
Institutional Source Beutler Lab
Gene Symbol Clgn
Ensembl Gene ENSMUSG00000002190
Gene Namecalmegin
Synonyms4930459O04Rik, A2/6, Cln, calnexin-t
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83389867-83428552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83400036 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 122 (I122T)
Ref Sequence ENSEMBL: ENSMUSP00000105457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002259] [ENSMUST00000109831]
Predicted Effect probably benign
Transcript: ENSMUST00000002259
AA Change: I122T

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002259
Gene: ENSMUSG00000002190
AA Change: I122T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Calreticulin 62 429 6.6e-160 PFAM
transmembrane domain 471 493 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109831
AA Change: I122T

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105457
Gene: ENSMUSG00000002190
AA Change: I122T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Calreticulin 60 429 1.9e-154 PFAM
transmembrane domain 471 493 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the calreticulin family, which includes calreticulin, calnexin, and calmegin, and encodes a calcium-binding molecular chaperone specifically expressed in pachytene stage male germ cells. It is required for the proper folding of newly synthesized membrane proteins in the endoplasmic reticulum including those critical for sperm migration from the uterus into the oviduct and sperm adhesion to and penetration of the zona pellucida. This gene plays a key role in spermatogenesis and male infertility. Alternative splice variants exist for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit severely impaired fertility associated with an apparent defect in either sperm/zona pellucida binding and/or sperm transit to the oviduct. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Clgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Clgn APN 8 83397650 missense probably damaging 1.00
IGL02158:Clgn APN 8 83423136 missense probably damaging 1.00
IGL03077:Clgn APN 8 83424140 missense probably benign 0.05
PIT4260001:Clgn UTSW 8 83423124 missense probably damaging 0.99
R0604:Clgn UTSW 8 83424194 missense probably benign 0.01
R1728:Clgn UTSW 8 83423030 missense probably damaging 0.98
R1729:Clgn UTSW 8 83423030 missense probably damaging 0.98
R2059:Clgn UTSW 8 83399978 missense probably benign 0.01
R2182:Clgn UTSW 8 83410410 missense possibly damaging 0.80
R3821:Clgn UTSW 8 83420477 missense probably null 0.02
R4542:Clgn UTSW 8 83420209 missense probably damaging 1.00
R5097:Clgn UTSW 8 83410523 missense possibly damaging 0.90
R5677:Clgn UTSW 8 83409538 missense probably damaging 1.00
R5752:Clgn UTSW 8 83397041 missense probably damaging 0.99
R5802:Clgn UTSW 8 83425614 missense probably damaging 1.00
R7542:Clgn UTSW 8 83395545 missense possibly damaging 0.90
R7563:Clgn UTSW 8 83420556 missense probably damaging 1.00
R7819:Clgn UTSW 8 83408200 missense possibly damaging 0.87
RF022:Clgn UTSW 8 83425606 missense probably damaging 1.00
Z1177:Clgn UTSW 8 83397681 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCAGTATTCACGGGAAGGGATC -3'
(R):5'- TGCTTACGCATACATACGTTTGTC -3'

Sequencing Primer
(F):5'- TCAGAAGTGACAACGGCTG -3'
(R):5'- CATACGTTTGTCTATGAACCTGG -3'
Posted On2018-06-22