Incidental Mutation 'R6584:Fbxw14'
ID524288
Institutional Source Beutler Lab
Gene Symbol Fbxw14
Ensembl Gene ENSMUSG00000105589
Gene NameF-box and WD-40 domain protein 14
SynonymsE330009N23Rik, Fbxo12, Fbx12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location109270790-109287676 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 109286543 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 53 (C53S)
Ref Sequence ENSEMBL: ENSMUSP00000143404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112041] [ENSMUST00000198844] [ENSMUST00000198928]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112041
AA Change: C53S

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107672
Gene: ENSMUSG00000105589
AA Change: C53S

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 114 208 2e-3 SMART
Blast:WD40 136 175 4e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000198844
AA Change: C53S

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143404
Gene: ENSMUSG00000105589
AA Change: C53S

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 114 249 4e-9 SMART
Blast:WD40 136 175 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198928
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Fbxw14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Fbxw14 APN 9 109278791 missense probably damaging 1.00
IGL01351:Fbxw14 APN 9 109274572 missense possibly damaging 0.47
IGL01654:Fbxw14 APN 9 109286580 splice site probably benign
K3955:Fbxw14 UTSW 9 109276245 missense possibly damaging 0.87
R0064:Fbxw14 UTSW 9 109287592 nonsense probably null
R0133:Fbxw14 UTSW 9 109274579 missense probably benign 0.02
R0975:Fbxw14 UTSW 9 109271239 missense probably benign 0.00
R1124:Fbxw14 UTSW 9 109276168 missense possibly damaging 0.48
R1782:Fbxw14 UTSW 9 109278691 missense possibly damaging 0.94
R2118:Fbxw14 UTSW 9 109274624 splice site probably benign
R3881:Fbxw14 UTSW 9 109271194 missense possibly damaging 0.95
R4641:Fbxw14 UTSW 9 109278682 critical splice donor site probably null
R4915:Fbxw14 UTSW 9 109274524 missense possibly damaging 0.82
R4952:Fbxw14 UTSW 9 109276201 missense probably benign 0.01
R6137:Fbxw14 UTSW 9 109276222 missense probably damaging 1.00
R6187:Fbxw14 UTSW 9 109276264 missense probably damaging 1.00
R7130:Fbxw14 UTSW 9 109271282 missense probably benign 0.02
R7845:Fbxw14 UTSW 9 109287603 missense probably damaging 1.00
R7928:Fbxw14 UTSW 9 109287603 missense probably damaging 1.00
R8049:Fbxw14 UTSW 9 109276143 missense probably damaging 0.98
X0067:Fbxw14 UTSW 9 109276201 missense probably benign 0.01
Z1177:Fbxw14 UTSW 9 109276246 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAAGTGGGTGTCTCTTCTAGAG -3'
(R):5'- GCAAGCAGTGATGTCCTGTG -3'

Sequencing Primer
(F):5'- GGTGTCTCTTCTAGAGTACCCAAG -3'
(R):5'- CAGTGATGTCCTGTGGAGGTAAG -3'
Posted On2018-06-22