Incidental Mutation 'R6584:Il22'
ID 524291
Institutional Source Beutler Lab
Gene Symbol Il22
Ensembl Gene ENSMUSG00000074695
Gene Name interleukin 22
Synonyms IL-TIF, Iltif, IL-22
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock # R6584 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 118204942-118210047 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118205027 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 13 (M13L)
Ref Sequence ENSEMBL: ENSMUSP00000094449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096691]
AlphaFold Q9JJY9
Predicted Effect probably benign
Transcript: ENSMUST00000096691
AA Change: M13L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094449
Gene: ENSMUSG00000074695
AA Change: M13L

DomainStartEndE-ValueType
IL10 49 179 7.88e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutation of this locus results in abnormalities in Il23-induced dermal inflammation and acanthosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Il22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03204:Il22 APN 10 118205180 splice site probably benign
IGL03290:Il22 APN 10 118205880 critical splice donor site probably null
PIT4651001:Il22 UTSW 10 118205590 missense probably damaging 1.00
R0184:Il22 UTSW 10 118205606 missense probably damaging 1.00
R3905:Il22 UTSW 10 118205624 nonsense probably null
R3908:Il22 UTSW 10 118205624 nonsense probably null
R4703:Il22 UTSW 10 118205606 missense probably damaging 1.00
R4797:Il22 UTSW 10 118205153 missense probably damaging 0.98
R4799:Il22 UTSW 10 118205153 missense probably damaging 0.98
R5439:Il22 UTSW 10 118209461 nonsense probably null
R5496:Il22 UTSW 10 118205097 missense possibly damaging 0.73
R5957:Il22 UTSW 10 118205166 missense probably damaging 1.00
R6862:Il22 UTSW 10 118205810 missense probably benign 0.41
R7381:Il22 UTSW 10 118205164 missense possibly damaging 0.48
R8095:Il22 UTSW 10 118205123 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTAAGCACTCAGACCTCTACAG -3'
(R):5'- CCCTAAAGAGTTTGCACGCG -3'

Sequencing Primer
(F):5'- CAGACAATCATCTGCTTGGTACCATG -3'
(R):5'- TAAAGAGTTTGCACGCGCTTCAG -3'
Posted On 2018-06-22