Incidental Mutation 'R6584:St6galnac2'
ID524294
Institutional Source Beutler Lab
Gene Symbol St6galnac2
Ensembl Gene ENSMUSG00000110170
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
SynonymsSiat7b, ST6GalNAc II, Siat7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6584 (G1)
Quality Score88.0076
Status Not validated
Chromosome11
Chromosomal Location116677483-116681290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116694504 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 19 (S19P)
Ref Sequence ENSEMBL: ENSMUSP00000078501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079545]
Predicted Effect probably benign
Transcript: ENSMUST00000079545
AA Change: S19P

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078501
Gene: ENSMUSG00000057286
AA Change: S19P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 90 373 2.9e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145441
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ST6GALNAC2 belongs to a family of sialyltransferases that add sialic acids to the nonreducing ends of glycoconjugates. At the cell surface, these modifications have roles in cell-cell and cell-substrate interactions, bacterial adhesion, and protein targeting (Samyn-Petit et al., 2000 [PubMed 10742600]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased body weight, decreased IgQ, increased B cell proliferation, increased pre-B cell number, abnormal erythropoiesis, increased ALT, decreased creatinine level and prominent spleen germinal center. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in St6galnac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01726:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01727:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01733:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL03353:St6galnac2 APN 11 116690302 splice site probably benign
R1521:St6galnac2 UTSW 11 116684347 missense possibly damaging 0.79
R1524:St6galnac2 UTSW 11 116684487 unclassified probably benign
R1855:St6galnac2 UTSW 11 116690315 missense probably benign 0.02
R2307:St6galnac2 UTSW 11 116681905 missense probably damaging 1.00
R4079:St6galnac2 UTSW 11 116681898 missense possibly damaging 0.69
R4658:St6galnac2 UTSW 11 116684525 unclassified probably benign
R5174:St6galnac2 UTSW 11 116681947 missense probably damaging 0.99
R5436:St6galnac2 UTSW 11 116684527 unclassified probably benign
R5655:St6galnac2 UTSW 11 116685146 missense probably damaging 1.00
R6702:St6galnac2 UTSW 11 116684387 missense probably benign 0.38
R6703:St6galnac2 UTSW 11 116684387 missense probably benign 0.38
R7090:St6galnac2 UTSW 11 116677635 missense probably damaging 1.00
R7368:St6galnac2 UTSW 11 116679979 missense probably damaging 1.00
R7607:St6galnac2 UTSW 11 116679979 missense probably damaging 1.00
R7728:St6galnac2 UTSW 11 116679985 missense probably benign 0.02
R7751:St6galnac2 UTSW 11 116677584 missense probably damaging 1.00
R7851:St6galnac2 UTSW 11 116685938 missense probably benign 0.04
R7934:St6galnac2 UTSW 11 116685938 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTAGGCCTGGACGGAATTCAC -3'
(R):5'- TGGAGTTGCTGCGACCTAAG -3'

Sequencing Primer
(F):5'- TGCTCCGGACCGAGCAAAG -3'
(R):5'- TTGCTGCGACCTAAGGCCTG -3'
Posted On2018-06-22