Incidental Mutation 'R6584:Agr2'
ID524296
Institutional Source Beutler Lab
Gene Symbol Agr2
Ensembl Gene ENSMUSG00000020581
Gene Nameanterior gradient 2
SynonymsXAG-2, mAG-2, Gob-4, HAG-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location35992907-36004087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35995626 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 37 (R37Q)
Ref Sequence ENSEMBL: ENSMUSP00000020898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020898]
Predicted Effect probably benign
Transcript: ENSMUST00000020898
AA Change: R37Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020898
Gene: ENSMUSG00000020581
AA Change: R37Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin_7 53 133 1.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147861
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This protein plays a role in cell migration, cellular transformation and metastasis and is as a p53 inhibitor. As an ER-localized molecular chaperone, it plays a role in the folding, trafficking, and assembly of cysteine-rich transmembrane receptors and the cysteine-rich intestinal gylcoprotein mucin. This gene has been implicated in inflammatory bowel disease and cancer progression. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit colitis and increased susceptibility to induced colitis. Mice homozygous for another knock-out allele exhibit hyperplasia and defective lineage maturation in the stomach that leads to intestinal obstruction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Agr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Agr2 APN 12 35995581 missense possibly damaging 0.63
IGL02081:Agr2 APN 12 35995656 critical splice donor site probably null
IGL03190:Agr2 APN 12 35998635 missense probably damaging 1.00
IGL02835:Agr2 UTSW 12 35995904 missense probably benign 0.23
R5514:Agr2 UTSW 12 35996091 missense probably benign
R5894:Agr2 UTSW 12 35995510 splice site probably benign
R6196:Agr2 UTSW 12 35995592 nonsense probably null
R6585:Agr2 UTSW 12 35995626 missense probably benign
R6850:Agr2 UTSW 12 35995559 missense probably benign
R7384:Agr2 UTSW 12 35995924 missense probably damaging 0.98
R7459:Agr2 UTSW 12 35997453 missense probably benign 0.20
R7533:Agr2 UTSW 12 35996129 critical splice donor site probably null
R7567:Agr2 UTSW 12 35995947 missense probably benign 0.00
R8039:Agr2 UTSW 12 35995559 missense probably benign 0.10
R8118:Agr2 UTSW 12 35996107 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TTCCACCACTGCGATAGACTC -3'
(R):5'- AGAGTTTCAGGCCCAAACC -3'

Sequencing Primer
(F):5'- ACCACTGCGATAGACTCTGTAATTC -3'
(R):5'- CCTGCTGAGCCTGGATAATAGATAC -3'
Posted On2018-06-22