Incidental Mutation 'R6619:Rasgrf2'
ID 524304
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene Name RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms Grf2, 6330417G04Rik
MMRRC Submission 044742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R6619 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 92028519-92268164 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92165027 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 380 (F380I)
Ref Sequence ENSEMBL: ENSMUSP00000149731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]
AlphaFold P70392
Predicted Effect probably damaging
Transcript: ENSMUST00000099326
AA Change: F380I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: F380I

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146492
AA Change: F380I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708
AA Change: F380I

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
Pfam:RhoGEF 247 387 1.2e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000149630
AA Change: F160I
SMART Domains Protein: ENSMUSP00000115562
Gene: ENSMUSG00000021708
AA Change: F160I

DomainStartEndE-ValueType
Pfam:RhoGEF 28 168 4.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216219
AA Change: F380I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8059 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 G A 16: 29,167,833 (GRCm39) P109S probably benign Het
Baiap2l1 T C 5: 144,222,916 (GRCm39) K106R probably benign Het
Coro6 A G 11: 77,357,030 (GRCm39) I111V possibly damaging Het
Crocc2 A G 1: 93,118,223 (GRCm39) E382G probably benign Het
Dhrs7l A T 12: 72,668,724 (GRCm39) N44K possibly damaging Het
Dnah5 C A 15: 28,409,266 (GRCm39) N3561K probably benign Het
Dsc2 T A 18: 20,165,335 (GRCm39) E879D probably benign Het
Frk A G 10: 34,481,835 (GRCm39) Y375C probably benign Het
Herc2 A T 7: 55,717,840 (GRCm39) R61* probably null Het
Jarid2 A G 13: 45,027,872 (GRCm39) D146G probably damaging Het
Lancl2 C A 6: 57,699,566 (GRCm39) T127K probably damaging Het
Large1 G A 8: 73,609,892 (GRCm39) Q359* probably null Het
Mast2 C A 4: 116,173,694 (GRCm39) E521* probably null Het
Mrc1 T A 2: 14,299,597 (GRCm39) probably null Het
Obi1 T C 14: 104,759,993 (GRCm39) H19R possibly damaging Het
Or4z4 A G 19: 12,076,727 (GRCm39) I92T probably damaging Het
Or5ak23 T C 2: 85,244,425 (GRCm39) N266S probably benign Het
Or6c38 A T 10: 128,929,323 (GRCm39) D173E possibly damaging Het
Or8k38 T C 2: 86,488,406 (GRCm39) Y132C probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
P2ry14 T C 3: 59,023,154 (GRCm39) Y102C probably damaging Het
Pcdhga6 T A 18: 37,842,702 (GRCm39) D807E probably benign Het
Pcdhgb4 T A 18: 37,854,737 (GRCm39) N377K probably damaging Het
Phf13 T A 4: 152,076,114 (GRCm39) N263Y probably damaging Het
Rab19 T A 6: 39,365,060 (GRCm39) S107T probably damaging Het
Reep1 T C 6: 71,784,826 (GRCm39) probably benign Het
Rpgrip1l C T 8: 91,959,499 (GRCm39) E1134K possibly damaging Het
Serpina3m A T 12: 104,357,766 (GRCm39) Y230F probably benign Het
Skint3 T C 4: 112,111,061 (GRCm39) I62T probably damaging Het
Smg6 T C 11: 74,823,279 (GRCm39) probably null Het
Sp4 G A 12: 118,263,077 (GRCm39) T323I possibly damaging Het
Strc A G 2: 121,198,913 (GRCm39) I1378T probably damaging Het
Tepsin C T 11: 119,986,428 (GRCm39) G128D probably benign Het
Togaram2 A G 17: 71,996,266 (GRCm39) N89D probably damaging Het
Trim36 T C 18: 46,321,475 (GRCm39) T191A probably damaging Het
Trp53bp1 A T 2: 121,077,980 (GRCm39) probably null Het
Zfp418 G A 7: 7,184,895 (GRCm39) C286Y probably damaging Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92,159,425 (GRCm39) splice site probably benign
IGL01358:Rasgrf2 APN 13 92,130,749 (GRCm39) missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92,174,718 (GRCm39) missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 92,130,857 (GRCm39) missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 92,136,145 (GRCm39) missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92,267,900 (GRCm39) missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92,167,273 (GRCm39) missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 92,131,752 (GRCm39) missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92,159,413 (GRCm39) missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 92,136,098 (GRCm39) missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 92,044,170 (GRCm39) missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 92,067,936 (GRCm39) splice site probably benign
R0632:Rasgrf2 UTSW 13 92,120,393 (GRCm39) missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 92,130,890 (GRCm39) missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92,165,174 (GRCm39) missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 92,035,808 (GRCm39) missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92,167,396 (GRCm39) missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 92,131,795 (GRCm39) missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 92,044,205 (GRCm39) missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 92,038,783 (GRCm39) missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 92,050,740 (GRCm39) missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 92,117,149 (GRCm39) missense probably benign
R1934:Rasgrf2 UTSW 13 92,131,825 (GRCm39) splice site probably null
R1990:Rasgrf2 UTSW 13 92,172,473 (GRCm39) missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 92,050,748 (GRCm39) missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92,167,351 (GRCm39) missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 92,120,374 (GRCm39) missense probably benign
R2193:Rasgrf2 UTSW 13 92,160,221 (GRCm39) splice site probably null
R2406:Rasgrf2 UTSW 13 92,120,359 (GRCm39) missense probably benign
R3055:Rasgrf2 UTSW 13 92,165,583 (GRCm39) missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92,167,296 (GRCm39) missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 92,130,773 (GRCm39) missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 92,033,773 (GRCm39) nonsense probably null
R4576:Rasgrf2 UTSW 13 92,044,529 (GRCm39) missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92,174,789 (GRCm39) missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 92,138,716 (GRCm39) critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 92,131,780 (GRCm39) missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 92,136,135 (GRCm39) missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92,160,190 (GRCm39) missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 92,044,155 (GRCm39) missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92,267,941 (GRCm39) missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 92,068,011 (GRCm39) missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92,165,609 (GRCm39) missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92,167,293 (GRCm39) missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92,267,954 (GRCm39) missense probably benign
R6428:Rasgrf2 UTSW 13 92,136,100 (GRCm39) missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92,167,361 (GRCm39) missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 92,033,754 (GRCm39) missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 92,131,732 (GRCm39) missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 92,130,952 (GRCm39) missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92,159,100 (GRCm39) intron probably benign
R7056:Rasgrf2 UTSW 13 92,167,203 (GRCm39) missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 92,034,521 (GRCm39) missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 92,032,637 (GRCm39) nonsense probably null
R7392:Rasgrf2 UTSW 13 92,041,856 (GRCm39) missense
R7469:Rasgrf2 UTSW 13 92,165,530 (GRCm39) critical splice donor site probably null
R7618:Rasgrf2 UTSW 13 92,136,085 (GRCm39) missense
R7641:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7674:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7784:Rasgrf2 UTSW 13 92,044,201 (GRCm39) missense
R7962:Rasgrf2 UTSW 13 92,167,300 (GRCm39) missense probably damaging 0.99
R8056:Rasgrf2 UTSW 13 92,167,321 (GRCm39) missense probably damaging 0.97
R8218:Rasgrf2 UTSW 13 92,130,796 (GRCm39) missense
R8796:Rasgrf2 UTSW 13 92,038,685 (GRCm39) missense
R8913:Rasgrf2 UTSW 13 92,159,034 (GRCm39) missense probably benign 0.05
R8971:Rasgrf2 UTSW 13 92,158,225 (GRCm39) missense possibly damaging 0.80
R9020:Rasgrf2 UTSW 13 92,165,146 (GRCm39) missense possibly damaging 0.93
R9487:Rasgrf2 UTSW 13 92,267,759 (GRCm39) missense probably benign
R9562:Rasgrf2 UTSW 13 92,034,469 (GRCm39) critical splice donor site probably null
R9712:Rasgrf2 UTSW 13 92,136,092 (GRCm39) missense
R9766:Rasgrf2 UTSW 13 92,160,188 (GRCm39) missense probably damaging 1.00
R9800:Rasgrf2 UTSW 13 92,267,860 (GRCm39) missense probably damaging 0.99
X0013:Rasgrf2 UTSW 13 92,167,363 (GRCm39) missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 92,050,654 (GRCm39) missense probably damaging 0.99
Z1177:Rasgrf2 UTSW 13 92,159,081 (GRCm39) missense unknown
Z1177:Rasgrf2 UTSW 13 92,131,632 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TTTGCCTCAAAAGATCCCTGC -3'
(R):5'- CCAGCGGATCTATTTGATATTTTGC -3'

Sequencing Primer
(F):5'- TTGCCTAGGACGCTCAAAG -3'
(R):5'- CTGCCCATGCTGAACATTTATCAAG -3'
Posted On 2018-06-22