Incidental Mutation 'R6584:Igf2r'
ID 524305
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission 044708-MU
Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene? Probably essential (E-score: 0.919) question?
Stock # R6584 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 12682406-12769664 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12701250 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 1401 (C1401R)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
AlphaFold Q07113
Predicted Effect probably damaging
Transcript: ENSMUST00000024599
AA Change: C1401R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: C1401R

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161738
AA Change: C10R
SMART Domains Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830
AA Change: C10R

DomainStartEndE-ValueType
Pfam:CIMR 1 65 3.1e-24 PFAM
Pfam:CIMR 68 129 6.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 (GRCm38) N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 (GRCm38) R37Q probably benign Het
Amfr T C 8: 93,974,155 (GRCm38) D559G probably benign Het
Atg2b T C 12: 105,657,995 (GRCm38) Y711C probably damaging Het
Clgn T C 8: 83,400,036 (GRCm38) I122T probably benign Het
Ets1 T A 9: 32,733,997 (GRCm38) F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 (GRCm38) C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 (GRCm38) T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 (GRCm38) L83P probably damaging Het
Il22 A T 10: 118,205,027 (GRCm38) M13L probably benign Het
Il9r A G 11: 32,191,782 (GRCm38) Y319H probably benign Het
Itgb5 T C 16: 33,885,030 (GRCm38) F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 (GRCm38) I26N possibly damaging Het
Lrba C T 3: 86,664,576 (GRCm38) R300C probably damaging Het
Map3k4 A C 17: 12,260,491 (GRCm38) Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 (GRCm38) K427N probably benign Het
Olfr107 G A 17: 37,405,905 (GRCm38) R119H probably benign Het
Paxip1 G A 5: 27,758,452 (GRCm38) H792Y probably damaging Het
Phf20 T C 2: 156,294,123 (GRCm38) S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 (GRCm38) G738V probably damaging Het
Smurf1 T C 5: 144,882,523 (GRCm38) D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 (GRCm38) S19P probably benign Het
Stra6l G A 4: 45,869,635 (GRCm38) probably null Het
Tbc1d9 C A 8: 83,261,000 (GRCm38) Q863K probably damaging Het
Traf1 T A 2: 34,958,058 (GRCm38) D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 (GRCm38) M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 (GRCm38) Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 (GRCm38) M339V probably benign Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12,713,990 (GRCm38) missense probably benign 0.01
IGL00534:Igf2r APN 17 12,739,328 (GRCm38) missense probably damaging 0.97
IGL00902:Igf2r APN 17 12,700,358 (GRCm38) missense probably damaging 0.99
IGL00903:Igf2r APN 17 12,683,867 (GRCm38) missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12,704,775 (GRCm38) missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12,695,374 (GRCm38) missense probably benign 0.01
IGL01392:Igf2r APN 17 12,704,349 (GRCm38) missense probably benign
IGL01557:Igf2r APN 17 12,704,635 (GRCm38) missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12,683,985 (GRCm38) missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12,725,415 (GRCm38) nonsense probably null
IGL01720:Igf2r APN 17 12,701,313 (GRCm38) missense probably damaging 0.99
IGL01756:Igf2r APN 17 12,683,822 (GRCm38) missense probably benign
IGL01839:Igf2r APN 17 12,705,022 (GRCm38) missense probably damaging 1.00
IGL01904:Igf2r APN 17 12,714,911 (GRCm38) missense probably damaging 0.99
IGL01965:Igf2r APN 17 12,704,338 (GRCm38) missense probably benign 0.12
IGL02083:Igf2r APN 17 12,693,192 (GRCm38) nonsense probably null
IGL02095:Igf2r APN 17 12,702,005 (GRCm38) missense probably damaging 0.99
IGL02183:Igf2r APN 17 12,698,516 (GRCm38) unclassified probably benign
IGL02576:Igf2r APN 17 12,748,763 (GRCm38) missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12,712,087 (GRCm38) missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12,719,883 (GRCm38) missense probably damaging 0.98
IGL02833:Igf2r APN 17 12,692,723 (GRCm38) missense probably damaging 0.97
IGL02885:Igf2r APN 17 12,694,120 (GRCm38) missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12,710,746 (GRCm38) splice site probably benign
IGL03080:Igf2r APN 17 12,726,676 (GRCm38) missense probably benign 0.06
IGL03176:Igf2r APN 17 12,716,672 (GRCm38) missense probably damaging 1.00
blunt UTSW 17 12,722,175 (GRCm38) missense probably benign 0.02
brusque UTSW 17 12,714,951 (GRCm38) missense probably damaging 0.98
gruff UTSW 17 12,684,097 (GRCm38) missense probably damaging 0.96
outlier UTSW 17 12,695,314 (GRCm38) missense probably benign 0.20
NA:Igf2r UTSW 17 12,691,962 (GRCm38) missense probably benign
R0165:Igf2r UTSW 17 12,698,527 (GRCm38) missense probably benign 0.07
R0412:Igf2r UTSW 17 12,683,948 (GRCm38) missense probably damaging 0.98
R0523:Igf2r UTSW 17 12,692,064 (GRCm38) missense probably benign 0.27
R0631:Igf2r UTSW 17 12,717,274 (GRCm38) splice site probably null
R0722:Igf2r UTSW 17 12,715,495 (GRCm38) critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12,692,101 (GRCm38) missense probably benign 0.02
R1265:Igf2r UTSW 17 12,694,124 (GRCm38) missense probably damaging 0.98
R1466:Igf2r UTSW 17 12,717,269 (GRCm38) splice site probably benign
R1485:Igf2r UTSW 17 12,691,285 (GRCm38) missense probably damaging 1.00
R1633:Igf2r UTSW 17 12,726,309 (GRCm38) missense probably benign
R1693:Igf2r UTSW 17 12,704,316 (GRCm38) missense probably damaging 0.97
R1751:Igf2r UTSW 17 12,697,441 (GRCm38) missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12,704,270 (GRCm38) critical splice donor site probably null
R1981:Igf2r UTSW 17 12,733,903 (GRCm38) nonsense probably null
R1994:Igf2r UTSW 17 12,692,738 (GRCm38) missense probably benign
R2060:Igf2r UTSW 17 12,701,319 (GRCm38) missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12,698,251 (GRCm38) missense probably benign 0.02
R2132:Igf2r UTSW 17 12,722,208 (GRCm38) missense probably benign 0.12
R2314:Igf2r UTSW 17 12,715,943 (GRCm38) missense probably benign 0.28
R2349:Igf2r UTSW 17 12,722,311 (GRCm38) splice site probably null
R2696:Igf2r UTSW 17 12,695,344 (GRCm38) missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12,686,724 (GRCm38) missense probably damaging 0.99
R2865:Igf2r UTSW 17 12,686,724 (GRCm38) missense probably damaging 0.99
R3884:Igf2r UTSW 17 12,709,468 (GRCm38) missense probably benign
R3930:Igf2r UTSW 17 12,705,829 (GRCm38) missense probably benign 0.01
R4021:Igf2r UTSW 17 12,748,751 (GRCm38) missense probably damaging 0.97
R4125:Igf2r UTSW 17 12,702,254 (GRCm38) missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12,703,465 (GRCm38) missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12,684,126 (GRCm38) missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12,684,097 (GRCm38) missense probably damaging 0.96
R4826:Igf2r UTSW 17 12,701,353 (GRCm38) missense probably damaging 0.98
R4933:Igf2r UTSW 17 12,691,877 (GRCm38) splice site probably null
R4980:Igf2r UTSW 17 12,703,360 (GRCm38) critical splice donor site probably null
R5389:Igf2r UTSW 17 12,725,416 (GRCm38) missense probably damaging 1.00
R5473:Igf2r UTSW 17 12,695,314 (GRCm38) missense probably benign 0.20
R5494:Igf2r UTSW 17 12,693,145 (GRCm38) missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12,739,334 (GRCm38) missense probably damaging 1.00
R5738:Igf2r UTSW 17 12,717,367 (GRCm38) missense probably benign 0.23
R5761:Igf2r UTSW 17 12,698,352 (GRCm38) splice site probably null
R5794:Igf2r UTSW 17 12,709,445 (GRCm38) missense probably benign 0.37
R6210:Igf2r UTSW 17 12,714,951 (GRCm38) missense probably damaging 0.98
R6319:Igf2r UTSW 17 12,714,113 (GRCm38) missense probably damaging 1.00
R6388:Igf2r UTSW 17 12,683,900 (GRCm38) missense probably benign
R6396:Igf2r UTSW 17 12,714,090 (GRCm38) missense probably benign 0.00
R6590:Igf2r UTSW 17 12,691,937 (GRCm38) nonsense probably null
R6591:Igf2r UTSW 17 12,689,008 (GRCm38) missense probably damaging 1.00
R6599:Igf2r UTSW 17 12,698,618 (GRCm38) missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12,691,937 (GRCm38) nonsense probably null
R6691:Igf2r UTSW 17 12,689,008 (GRCm38) missense probably damaging 1.00
R6752:Igf2r UTSW 17 12,714,944 (GRCm38) missense probably damaging 1.00
R6816:Igf2r UTSW 17 12,714,082 (GRCm38) missense probably damaging 0.99
R6841:Igf2r UTSW 17 12,703,376 (GRCm38) missense probably damaging 0.97
R6877:Igf2r UTSW 17 12,697,341 (GRCm38) missense probably damaging 0.97
R6950:Igf2r UTSW 17 12,718,718 (GRCm38) missense probably benign
R7030:Igf2r UTSW 17 12,733,866 (GRCm38) missense probably damaging 1.00
R7038:Igf2r UTSW 17 12,698,325 (GRCm38) missense probably benign 0.23
R7055:Igf2r UTSW 17 12,704,323 (GRCm38) missense probably damaging 0.99
R7074:Igf2r UTSW 17 12,714,116 (GRCm38) missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12,703,484 (GRCm38) missense probably damaging 0.99
R7413:Igf2r UTSW 17 12,698,228 (GRCm38) nonsense probably null
R7463:Igf2r UTSW 17 12,710,645 (GRCm38) missense probably benign 0.16
R7619:Igf2r UTSW 17 12,698,273 (GRCm38) missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12,735,991 (GRCm38) missense probably damaging 0.98
R7733:Igf2r UTSW 17 12,739,369 (GRCm38) missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12,748,704 (GRCm38) missense probably benign
R8022:Igf2r UTSW 17 12,718,795 (GRCm38) missense probably damaging 1.00
R8138:Igf2r UTSW 17 12,701,238 (GRCm38) missense probably benign 0.32
R8220:Igf2r UTSW 17 12,692,071 (GRCm38) missense probably benign 0.22
R8305:Igf2r UTSW 17 12,733,860 (GRCm38) missense probably benign
R8359:Igf2r UTSW 17 12,683,861 (GRCm38) missense probably benign
R8500:Igf2r UTSW 17 12,709,441 (GRCm38) missense probably damaging 0.99
R8510:Igf2r UTSW 17 12,704,313 (GRCm38) missense probably benign 0.38
R8933:Igf2r UTSW 17 12,704,637 (GRCm38) missense probably damaging 1.00
R8933:Igf2r UTSW 17 12,701,244 (GRCm38) missense probably damaging 0.97
R8976:Igf2r UTSW 17 12,726,772 (GRCm38) missense probably damaging 1.00
R8994:Igf2r UTSW 17 12,716,650 (GRCm38) missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12,751,293 (GRCm38) start codon destroyed probably null
R9097:Igf2r UTSW 17 12,691,213 (GRCm38) missense probably damaging 1.00
R9127:Igf2r UTSW 17 12,739,351 (GRCm38) missense probably damaging 0.98
R9278:Igf2r UTSW 17 12,695,353 (GRCm38) missense probably damaging 1.00
R9362:Igf2r UTSW 17 12,722,175 (GRCm38) missense probably benign 0.02
R9371:Igf2r UTSW 17 12,705,759 (GRCm38) missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12,698,328 (GRCm38) missense probably benign 0.26
R9567:Igf2r UTSW 17 12,686,754 (GRCm38) missense probably damaging 1.00
R9665:Igf2r UTSW 17 12,694,140 (GRCm38) missense probably benign 0.17
R9666:Igf2r UTSW 17 12,726,701 (GRCm38) missense probably benign
X0028:Igf2r UTSW 17 12,704,913 (GRCm38) nonsense probably null
Z1177:Igf2r UTSW 17 12,697,399 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTCTTCAGTATCAACAGAGCC -3'
(R):5'- TGATGCTTGAGCCCTCTGAG -3'

Sequencing Primer
(F):5'- CCTGGGCCATATGGGAATCAATC -3'
(R):5'- TTGAGCCCTCTGAGGAGAG -3'
Posted On 2018-06-22