Incidental Mutation 'R6584:Wdr27'
ID 524307
Institutional Source Beutler Lab
Gene Symbol Wdr27
Ensembl Gene ENSMUSG00000046991
Gene Name WD repeat domain 27
Synonyms 0610012K18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock # R6584 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 14818519-14943158 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14901769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 625 (Y625F)
Ref Sequence ENSEMBL: ENSMUSP00000155992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170386] [ENSMUST00000228330] [ENSMUST00000232147]
AlphaFold Q8C5V5
Predicted Effect possibly damaging
Transcript: ENSMUST00000170386
AA Change: Y625F

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126736
Gene: ENSMUSG00000046991
AA Change: Y625F

DomainStartEndE-ValueType
WD40 59 99 4.79e-1 SMART
WD40 114 149 6.36e1 SMART
WD40 152 192 3.93e-7 SMART
WD40 195 235 2.38e1 SMART
low complexity region 473 492 N/A INTRINSIC
WD40 498 539 1.48e1 SMART
WD40 542 581 5.26e-8 SMART
WD40 642 684 2.97e0 SMART
WD40 687 737 7.64e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228233
Predicted Effect possibly damaging
Transcript: ENSMUST00000228330
AA Change: Y625F

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000232147
AA Change: Y625F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD repeats. Proteins with these repeats may form scaffolds for protein-protein interaction and play key roles in cell signalling. Alternative splicing results in multiple transcript variants, but the full-length structure of some of these variants cannot be determined. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Wdr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Wdr27 APN 17 14928310 nonsense probably null
IGL00973:Wdr27 APN 17 14913878 missense probably benign 0.01
IGL01012:Wdr27 APN 17 14926247 missense probably damaging 1.00
IGL01924:Wdr27 APN 17 14917226 missense probably damaging 0.99
IGL02044:Wdr27 APN 17 14901769 missense possibly damaging 0.72
IGL02198:Wdr27 APN 17 14908598 missense possibly damaging 0.52
IGL02430:Wdr27 APN 17 14901800 missense probably damaging 0.98
IGL02496:Wdr27 APN 17 14892431 splice site probably benign
IGL02552:Wdr27 APN 17 14926191 missense probably damaging 1.00
IGL02590:Wdr27 APN 17 14917779 missense possibly damaging 0.93
IGL02892:Wdr27 APN 17 14876176 missense possibly damaging 0.95
IGL02957:Wdr27 APN 17 14910110 splice site probably benign
IGL03295:Wdr27 APN 17 14934575 missense possibly damaging 0.71
PIT4498001:Wdr27 UTSW 17 14934569 missense probably benign 0.01
R0329:Wdr27 UTSW 17 14934459 splice site probably benign
R0671:Wdr27 UTSW 17 14928396 missense probably benign 0.04
R1166:Wdr27 UTSW 17 14892471 missense probably damaging 1.00
R1308:Wdr27 UTSW 17 14928384 missense probably damaging 0.98
R1652:Wdr27 UTSW 17 14917270 missense probably benign 0.01
R1771:Wdr27 UTSW 17 14892441 missense probably damaging 1.00
R1966:Wdr27 UTSW 17 14934599 missense possibly damaging 0.86
R2106:Wdr27 UTSW 17 14920854 missense probably benign 0.44
R2131:Wdr27 UTSW 17 14928332 missense probably damaging 1.00
R3803:Wdr27 UTSW 17 14918109 missense probably benign 0.01
R4335:Wdr27 UTSW 17 14920756 splice site probably null
R4577:Wdr27 UTSW 17 14903462 missense probably benign 0.00
R4787:Wdr27 UTSW 17 14932554 missense possibly damaging 0.86
R4853:Wdr27 UTSW 17 14917213 splice site probably null
R4922:Wdr27 UTSW 17 14920754 splice site probably null
R4951:Wdr27 UTSW 17 14876133 missense probably damaging 0.99
R5784:Wdr27 UTSW 17 14926233 missense probably damaging 1.00
R5809:Wdr27 UTSW 17 14883669 missense probably damaging 1.00
R6128:Wdr27 UTSW 17 14932534 nonsense probably null
R6705:Wdr27 UTSW 17 14934590 missense probably damaging 1.00
R7511:Wdr27 UTSW 17 14883703 missense probably benign 0.00
R8273:Wdr27 UTSW 17 14829576 missense probably benign
R8350:Wdr27 UTSW 17 14932525 missense probably benign
R8353:Wdr27 UTSW 17 14892489 missense probably benign 0.08
R8450:Wdr27 UTSW 17 14932525 missense probably benign
R8453:Wdr27 UTSW 17 14892489 missense probably benign 0.08
R8535:Wdr27 UTSW 17 14903537 missense possibly damaging 0.88
R8735:Wdr27 UTSW 17 14883667 missense probably damaging 1.00
R8960:Wdr27 UTSW 17 14883646 missense probably benign 0.01
R9120:Wdr27 UTSW 17 14932584 missense probably damaging 1.00
R9183:Wdr27 UTSW 17 14928389 missense possibly damaging 0.50
R9351:Wdr27 UTSW 17 14908571 missense possibly damaging 0.52
R9373:Wdr27 UTSW 17 14934533 missense probably benign 0.00
R9389:Wdr27 UTSW 17 14891718 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCCTTGCAAAAGTCTGTTGG -3'
(R):5'- GGTGGTGATAAAACGTGTGC -3'

Sequencing Primer
(F):5'- CCTTGCAAAAGTCTGTTGGGTTTTTG -3'
(R):5'- TAAAACGTGTGCAAGATGAGTAC -3'
Posted On 2018-06-22