Mutagenetix > Incidental Mutation

Incidental Mutation 'R6584:Wdr27'

524307

Institutional Source

Beutler Lab

Gene Symbol

Wdr27

Ensembl Gene

ENSMUSG00000046991

Gene Name

WD repeat domain 27

Synonyms

0610012K18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R6584 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14818519-14943158 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14901769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 625 (Y625F)

Ref Sequence

ENSEMBL: ENSMUSP00000155992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170386] [ENSMUST00000228330] [ENSMUST00000232147]

AlphaFold

Q8C5V5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170386
AA Change: Y625F

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126736
Gene: ENSMUSG00000046991
AA Change: Y625F

Domain	Start	End	E-Value	Type
WD40	59	99	4.79e-1	SMART
WD40	114	149	6.36e1	SMART
WD40	152	192	3.93e-7	SMART
WD40	195	235	2.38e1	SMART
low complexity region	473	492	N/A	INTRINSIC
WD40	498	539	1.48e1	SMART
WD40	542	581	5.26e-8	SMART
WD40	642	684	2.97e0	SMART
WD40	687	737	7.64e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228233

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228330
AA Change: Y625F

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably damaging
Transcript: ENSMUST00000232147
AA Change: Y625F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD repeats. Proteins with these repeats may form scaffolds for protein-protein interaction and play key roles in cell signalling. Alternative splicing results in multiple transcript variants, but the full-length structure of some of these variants cannot be determined. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	T	C	19: 29,718,728	N1122D	possibly damaging	Het
Agr2	G	A	12: 35,995,626	R37Q	probably benign	Het
Amfr	T	C	8: 93,974,155	D559G	probably benign	Het
Atg2b	T	C	12: 105,657,995	Y711C	probably damaging	Het
Clgn	T	C	8: 83,400,036	I122T	probably benign	Het
Ets1	T	A	9: 32,733,997	F180Y	probably damaging	Het
Fbxw14	C	G	9: 109,286,543	C53S	possibly damaging	Het
Gm13088	T	A	4: 143,655,470	T219S	possibly damaging	Het
Ifna9	A	G	4: 88,592,138	L83P	probably damaging	Het
Igf2r	A	G	17: 12,701,250	C1401R	probably damaging	Het
Il22	A	T	10: 118,205,027	M13L	probably benign	Het
Il9r	A	G	11: 32,191,782	Y319H	probably benign	Het
Itgb5	T	C	16: 33,885,030	F230S	probably damaging	Het
Klk1b27	T	A	7: 44,054,511	I26N	possibly damaging	Het
Lrba	C	T	3: 86,664,576	R300C	probably damaging	Het
Map3k4	A	C	17: 12,260,491	Y730D	probably damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr107	G	A	17: 37,405,905	R119H	probably benign	Het
Paxip1	G	A	5: 27,758,452	H792Y	probably damaging	Het
Phf20	T	C	2: 156,294,123	S621P	probably damaging	Het
Slitrk3	C	A	3: 73,049,225	G738V	probably damaging	Het
Smurf1	T	C	5: 144,882,523	D598G	probably damaging	Het
St6galnac2	A	G	11: 116,694,504	S19P	probably benign	Het
Stra6l	G	A	4: 45,869,635		probably null	Het
Tbc1d9	C	A	8: 83,261,000	Q863K	probably damaging	Het
Traf1	T	A	2: 34,958,058	D8V	probably damaging	Het
Vmn2r24	T	G	6: 123,815,805	M697R	possibly damaging	Het
Wdr49	T	C	3: 75,337,758	M339V	probably benign	Het

Other mutations in Wdr27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Wdr27	APN	17	14928310	nonsense	probably null
IGL00973:Wdr27	APN	17	14913878	missense	probably benign	0.01
IGL01012:Wdr27	APN	17	14926247	missense	probably damaging	1.00
IGL01924:Wdr27	APN	17	14917226	missense	probably damaging	0.99
IGL02044:Wdr27	APN	17	14901769	missense	possibly damaging	0.72
IGL02198:Wdr27	APN	17	14908598	missense	possibly damaging	0.52
IGL02430:Wdr27	APN	17	14901800	missense	probably damaging	0.98
IGL02496:Wdr27	APN	17	14892431	splice site	probably benign
IGL02552:Wdr27	APN	17	14926191	missense	probably damaging	1.00
IGL02590:Wdr27	APN	17	14917779	missense	possibly damaging	0.93
IGL02892:Wdr27	APN	17	14876176	missense	possibly damaging	0.95
IGL02957:Wdr27	APN	17	14910110	splice site	probably benign
IGL03295:Wdr27	APN	17	14934575	missense	possibly damaging	0.71
PIT4498001:Wdr27	UTSW	17	14934569	missense	probably benign	0.01
R0329:Wdr27	UTSW	17	14934459	splice site	probably benign
R0671:Wdr27	UTSW	17	14928396	missense	probably benign	0.04
R1166:Wdr27	UTSW	17	14892471	missense	probably damaging	1.00
R1308:Wdr27	UTSW	17	14928384	missense	probably damaging	0.98
R1652:Wdr27	UTSW	17	14917270	missense	probably benign	0.01
R1771:Wdr27	UTSW	17	14892441	missense	probably damaging	1.00
R1966:Wdr27	UTSW	17	14934599	missense	possibly damaging	0.86
R2106:Wdr27	UTSW	17	14920854	missense	probably benign	0.44
R2131:Wdr27	UTSW	17	14928332	missense	probably damaging	1.00
R3803:Wdr27	UTSW	17	14918109	missense	probably benign	0.01
R4335:Wdr27	UTSW	17	14920756	splice site	probably null
R4577:Wdr27	UTSW	17	14903462	missense	probably benign	0.00
R4787:Wdr27	UTSW	17	14932554	missense	possibly damaging	0.86
R4853:Wdr27	UTSW	17	14917213	splice site	probably null
R4922:Wdr27	UTSW	17	14920754	splice site	probably null
R4951:Wdr27	UTSW	17	14876133	missense	probably damaging	0.99
R5784:Wdr27	UTSW	17	14926233	missense	probably damaging	1.00
R5809:Wdr27	UTSW	17	14883669	missense	probably damaging	1.00
R6128:Wdr27	UTSW	17	14932534	nonsense	probably null
R6705:Wdr27	UTSW	17	14934590	missense	probably damaging	1.00
R7511:Wdr27	UTSW	17	14883703	missense	probably benign	0.00
R8273:Wdr27	UTSW	17	14829576	missense	probably benign
R8350:Wdr27	UTSW	17	14932525	missense	probably benign
R8353:Wdr27	UTSW	17	14892489	missense	probably benign	0.08
R8450:Wdr27	UTSW	17	14932525	missense	probably benign
R8453:Wdr27	UTSW	17	14892489	missense	probably benign	0.08
R8535:Wdr27	UTSW	17	14903537	missense	possibly damaging	0.88
R8735:Wdr27	UTSW	17	14883667	missense	probably damaging	1.00
R8960:Wdr27	UTSW	17	14883646	missense	probably benign	0.01
R9120:Wdr27	UTSW	17	14932584	missense	probably damaging	1.00
R9183:Wdr27	UTSW	17	14928389	missense	possibly damaging	0.50
R9351:Wdr27	UTSW	17	14908571	missense	possibly damaging	0.52
R9373:Wdr27	UTSW	17	14934533	missense	probably benign	0.00
R9389:Wdr27	UTSW	17	14891718	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CCCTTGCAAAAGTCTGTTGG -3'
(R):5'- GGTGGTGATAAAACGTGTGC -3'

Sequencing Primer
(F):5'- CCTTGCAAAAGTCTGTTGGGTTTTTG -3'
(R):5'- TAAAACGTGTGCAAGATGAGTAC -3'

Posted On

2018-06-22