Incidental Mutation 'R6584:Olfr107'
ID524309
Institutional Source Beutler Lab
Gene Symbol Olfr107
Ensembl Gene ENSMUSG00000063188
Gene Nameolfactory receptor 107
SynonymsMOR156-3, GA_x6K02T2PSCP-1867165-1868094
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37399226-37407477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37405905 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 119 (R119H)
Ref Sequence ENSEMBL: ENSMUSP00000148879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077008] [ENSMUST00000215894] [ENSMUST00000215947] [ENSMUST00000215974] [ENSMUST00000216844]
Predicted Effect probably benign
Transcript: ENSMUST00000077008
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076267
Gene: ENSMUSG00000063188
AA Change: R119H

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 32 302 1.3e-5 PFAM
Pfam:7tm_1 38 287 3.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174238
Predicted Effect probably benign
Transcript: ENSMUST00000215894
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215947
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215974
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216844
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Olfr107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Olfr107 APN 17 37406140 missense probably benign 0.00
IGL01614:Olfr107 APN 17 37405638 missense probably benign 0.00
IGL02390:Olfr107 APN 17 37406095 missense probably benign 0.04
R1051:Olfr107 UTSW 17 37406450 missense possibly damaging 0.74
R4767:Olfr107 UTSW 17 37406200 nonsense probably null
R4849:Olfr107 UTSW 17 37405698 missense probably benign 0.16
R6182:Olfr107 UTSW 17 37405992 missense possibly damaging 0.65
R6550:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6551:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6552:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6555:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6586:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6588:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6688:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6758:Olfr107 UTSW 17 37405695 missense probably damaging 0.97
R7024:Olfr107 UTSW 17 37406204 missense probably benign 0.04
R7083:Olfr107 UTSW 17 37406172 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCAGTCAGCTCTCACTAGTG -3'
(R):5'- ACTGAGGTGAGTGTCTGAGC -3'

Sequencing Primer
(F):5'- AGTCAGCTCTCACTAGTGGATCTTTG -3'
(R):5'- CAGTAAGAGAGGCCTAGAATCAC -3'
Posted On2018-06-22