Mutagenetix > Incidental Mutation

Incidental Mutation 'R6585:Dis3l2'

524313

Institutional Source

Beutler Lab

Gene Symbol

Dis3l2

Ensembl Gene

ENSMUSG00000053333

Gene Name

DIS3 like 3'-5' exoribonuclease 2

Synonyms

4930429A22Rik, 8030493P09Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.358) question?

Stock #

R6585 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86703808-87050095 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86745494 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 69 (I69N)

Ref Sequence

ENSEMBL: ENSMUSP00000139579 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]

AlphaFold

Q8CI75

Predicted Effect

probably damaging
Transcript: ENSMUST00000065694
AA Change: I69N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: I69N

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	369	719	8.9e-140	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168237
AA Change: I69N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: I69N

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	383	733	8.9e-140	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188121

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189044

Predicted Effect

probably damaging
Transcript: ENSMUST00000190618
AA Change: I69N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333
AA Change: I69N

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
PDB:2VNU\|D	50	123	4e-10	PDB

Meta Mutation Damage Score

0.9088

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,737,668	C108Y	probably damaging	Het
AA792892	C	T	5: 94,381,556	P62S	probably benign	Het
Adam1b	G	T	5: 121,501,187	D598E	probably benign	Het
Agr2	G	A	12: 35,995,626	R37Q	probably benign	Het
Ascc3	A	G	10: 50,842,177	K1989E	probably benign	Het
Chd1l	A	G	3: 97,597,772	F160L	probably damaging	Het
Ciita	T	A	16: 10,511,745	V628E	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Elp2	T	C	18: 24,625,549	L503S	probably damaging	Het
Fcgbp	A	T	7: 28,113,979	Q2313L	possibly damaging	Het
Gm14851	A	G	8: 21,095,232	C65R	possibly damaging	Het
Gpr155	A	T	2: 73,349,645	I157N	probably damaging	Het
Hist2h2bb	A	T	3: 96,270,097	T116S	probably benign	Het
Kcnj1	T	C	9: 32,397,261	V307A	probably benign	Het
Lama3	G	A	18: 12,419,257		probably null	Het
Lrp6	A	T	6: 134,507,558	Y367*	probably null	Het
Ms4a14	T	A	19: 11,303,645	Q516H	unknown	Het
Nprl3	C	T	11: 32,234,812	R399Q	probably benign	Het
Olfr273	A	T	4: 52,856,192	M107K	possibly damaging	Het
Olfr290	A	T	7: 84,916,462	I228F	probably damaging	Het
Park7	G	T	4: 150,905,264	Q80K	probably benign	Het
Pramef20	C	A	4: 144,377,030	L175F	possibly damaging	Het
Ptgs2	T	C	1: 150,103,987	V281A	possibly damaging	Het
Rprd1a	T	C	18: 24,506,663		probably null	Het
Speer4f2	A	G	5: 17,374,422	E73G	probably damaging	Het
Spta1	T	C	1: 174,178,685	W138R	probably damaging	Het
U2surp	T	C	9: 95,472,071	E838G	probably damaging	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp19	G	T	9: 108,499,727	L1165F	probably damaging	Het
Zfp27	G	A	7: 29,896,393	T49I	possibly damaging	Het

Other mutations in Dis3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Dis3l2	APN	1	86857203	missense	probably benign	0.00
IGL01607:Dis3l2	APN	1	86745487	missense	probably benign	0.04
IGL02233:Dis3l2	APN	1	86990231	missense	probably damaging	1.00
IGL02698:Dis3l2	APN	1	87048829	splice site	probably benign
R0514:Dis3l2	UTSW	1	87047092	missense	probably damaging	1.00
R0893:Dis3l2	UTSW	1	87044206	splice site	probably null
R1086:Dis3l2	UTSW	1	86990149	missense	probably benign	0.36
R1140:Dis3l2	UTSW	1	86821438	missense	probably benign	0.00
R1509:Dis3l2	UTSW	1	87021086	missense	possibly damaging	0.91
R2029:Dis3l2	UTSW	1	86854467	splice site	probably benign
R2511:Dis3l2	UTSW	1	86990258	missense	probably benign	0.05
R3772:Dis3l2	UTSW	1	86854408	missense	probably benign
R4163:Dis3l2	UTSW	1	86821237	missense	probably benign	0.00
R4547:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4548:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4650:Dis3l2	UTSW	1	86990321	missense	possibly damaging	0.83
R4810:Dis3l2	UTSW	1	87047574	missense	probably damaging	0.99
R4936:Dis3l2	UTSW	1	87044168	missense	probably benign	0.00
R5010:Dis3l2	UTSW	1	86760321	missense	probably benign	0.21
R5040:Dis3l2	UTSW	1	86857337	missense	probably damaging	0.98
R5272:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5500:Dis3l2	UTSW	1	87021119	critical splice donor site	probably null
R5556:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5772:Dis3l2	UTSW	1	86878432	missense	probably damaging	1.00
R5808:Dis3l2	UTSW	1	87049638	missense	possibly damaging	0.94
R5950:Dis3l2	UTSW	1	87021108	missense	probably damaging	0.96
R6328:Dis3l2	UTSW	1	86854431	missense	probably benign	0.05
R6553:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6905:Dis3l2	UTSW	1	87044839	missense	probably benign	0.00
R6921:Dis3l2	UTSW	1	86857341	missense	probably benign
R7162:Dis3l2	UTSW	1	87044030	missense	possibly damaging	0.94
R7270:Dis3l2	UTSW	1	86990303	missense	possibly damaging	0.49
R7438:Dis3l2	UTSW	1	86745500	critical splice donor site	probably null
R8422:Dis3l2	UTSW	1	86854377	missense	probably benign
R8696:Dis3l2	UTSW	1	86791440	nonsense	probably null
R9235:Dis3l2	UTSW	1	86821339	missense	possibly damaging	0.95
R9291:Dis3l2	UTSW	1	86973493	missense	possibly damaging	0.82
R9629:Dis3l2	UTSW	1	87047062	missense	probably benign	0.00
X0027:Dis3l2	UTSW	1	86760351	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGCTGCCTCATGTTTCTAGG -3'
(R):5'- CTAGGCAACATTGACATGAGC -3'

Sequencing Primer
(F):5'- GCCTCATGTTTCTAGGTGTGTCC -3'
(R):5'- CATTGACATGAGCTACAAAGGC -3'

Posted On

2018-06-22