Incidental Mutation 'R6585:Hist2h2bb'
ID524320
Institutional Source Beutler Lab
Gene Symbol Hist2h2bb
Ensembl Gene ENSMUSG00000105827
Gene Namehistone cluster 2, H2bb
SynonymsH2b-616
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location96269752-96270132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96270097 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 116 (T116S)
Ref Sequence ENSEMBL: ENSMUSP00000135427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098843] [ENSMUST00000177113]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051089
SMART Domains Protein: ENSMUSP00000059105
Gene: ENSMUSG00000050936

DomainStartEndE-ValueType
H2B 28 112 1.48e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098843
SMART Domains Protein: ENSMUSP00000096442
Gene: ENSMUSG00000074403

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177113
AA Change: T116S

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135427
Gene: ENSMUSG00000105827
AA Change: T116S

DomainStartEndE-ValueType
H2B 28 124 1.43e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193036
Meta Mutation Damage Score 0.1597 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Hist2h2bb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Hist2h2bb APN 3 96269809 unclassified probably benign
R0357:Hist2h2bb UTSW 3 96269788 missense probably null 0.04
R0882:Hist2h2bb UTSW 3 96269744 splice site probably null
R0976:Hist2h2bb UTSW 3 96270086 missense probably benign 0.19
R1473:Hist2h2bb UTSW 3 96270072 missense probably damaging 1.00
R1507:Hist2h2bb UTSW 3 96269873 missense probably damaging 1.00
R4503:Hist2h2bb UTSW 3 96269924 missense possibly damaging 0.84
R4751:Hist2h2bb UTSW 3 96269151 unclassified probably benign
R4808:Hist2h2bb UTSW 3 96270013 missense probably benign 0.00
R6118:Hist2h2bb UTSW 3 96269951 missense probably damaging 1.00
R7527:Hist2h2bb UTSW 3 96269870 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGACACGGGCATCTCATCTAAG -3'
(R):5'- CACTTTGAAACGCTCGATGTTG -3'

Sequencing Primer
(F):5'- ACGGGCATCTCATCTAAGGCTATG -3'
(R):5'- GAAACGCTCGATGTTGCACCAG -3'
Posted On2018-06-22