Mutagenetix > Incidental Mutations

Incidental Mutation 'R6585:Chd1l'

524322

Institutional Source

Beutler Lab

Gene Symbol

Chd1l

Ensembl Gene

ENSMUSG00000028089

Gene Name

chromodomain helicase DNA binding protein 1-like

Synonyms

4432404A22Rik, Snf2p

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.338) question?

Stock #

R6585 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

97560742-97610203 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97597772 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 160 (F160L)

Ref Sequence

ENSEMBL: ENSMUSP00000029730 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029730]

AlphaFold

Q9CXF7

Predicted Effect

probably damaging
Transcript: ENSMUST00000029730
AA Change: F160L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029730
Gene: ENSMUSG00000028089
AA Change: F160L

Domain	Start	End	E-Value	Type
DEXDc	36	224	1.83e-38	SMART
HELICc	371	453	7.45e-21	SMART
low complexity region	548	570	N/A	INTRINSIC
coiled coil region	643	680	N/A	INTRINSIC
low complexity region	692	709	N/A	INTRINSIC
PDB:2FG1\|A	718	878	6e-9	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197304

Meta Mutation Damage Score

0.4420

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase protein involved in DNA repair. The protein converts ATP to add poly(ADP-ribose) as it regulates chromatin relaxation following DNA damage. Overexpression of this gene has been linked to several types of cancers. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,737,668	C108Y	probably damaging	Het
AA792892	C	T	5: 94,381,556	P62S	probably benign	Het
Adam1b	G	T	5: 121,501,187	D598E	probably benign	Het
Agr2	G	A	12: 35,995,626	R37Q	probably benign	Het
Ascc3	A	G	10: 50,842,177	K1989E	probably benign	Het
Ciita	T	A	16: 10,511,745	V628E	probably benign	Het
Dis3l2	T	A	1: 86,745,494	I69N	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Elp2	T	C	18: 24,625,549	L503S	probably damaging	Het
Fcgbp	A	T	7: 28,113,979	Q2313L	possibly damaging	Het
Gm14851	A	G	8: 21,095,232	C65R	possibly damaging	Het
Gpr155	A	T	2: 73,349,645	I157N	probably damaging	Het
Hist2h2bb	A	T	3: 96,270,097	T116S	probably benign	Het
Kcnj1	T	C	9: 32,397,261	V307A	probably benign	Het
Lama3	G	A	18: 12,419,257		probably null	Het
Lrp6	A	T	6: 134,507,558	Y367*	probably null	Het
Ms4a14	T	A	19: 11,303,645	Q516H	unknown	Het
Nprl3	C	T	11: 32,234,812	R399Q	probably benign	Het
Olfr273	A	T	4: 52,856,192	M107K	possibly damaging	Het
Olfr290	A	T	7: 84,916,462	I228F	probably damaging	Het
Park7	G	T	4: 150,905,264	Q80K	probably benign	Het
Pramef20	C	A	4: 144,377,030	L175F	possibly damaging	Het
Ptgs2	T	C	1: 150,103,987	V281A	possibly damaging	Het
Rprd1a	T	C	18: 24,506,663		probably null	Het
Speer4f2	A	G	5: 17,374,422	E73G	probably damaging	Het
Spta1	T	C	1: 174,178,685	W138R	probably damaging	Het
U2surp	T	C	9: 95,472,071	E838G	probably damaging	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp19	G	T	9: 108,499,727	L1165F	probably damaging	Het
Zfp27	G	A	7: 29,896,393	T49I	possibly damaging	Het

Other mutations in Chd1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Chd1l	APN	3	97590605	missense	probably damaging	1.00
IGL01349:Chd1l	APN	3	97591234	missense	probably benign	0.07
IGL02115:Chd1l	APN	3	97589904	critical splice donor site	probably null
IGL02418:Chd1l	APN	3	97581099	missense	probably benign	0.39
IGL02717:Chd1l	APN	3	97583907	missense	probably damaging	1.00
IGL03091:Chd1l	APN	3	97563547	missense	probably damaging	1.00
IGL03048:Chd1l	UTSW	3	97597763	missense	probably benign	0.01
R0125:Chd1l	UTSW	3	97587149	missense	probably benign	0.00
R0702:Chd1l	UTSW	3	97566794	missense	probably benign	0.05
R1226:Chd1l	UTSW	3	97562625	nonsense	probably null
R1237:Chd1l	UTSW	3	97582731	missense	probably benign	0.01
R1238:Chd1l	UTSW	3	97582731	missense	probably benign	0.01
R1239:Chd1l	UTSW	3	97582731	missense	probably benign	0.01
R1301:Chd1l	UTSW	3	97603648	splice site	probably benign
R1366:Chd1l	UTSW	3	97581149	missense	probably damaging	0.99
R1444:Chd1l	UTSW	3	97582731	missense	probably benign	0.01
R1445:Chd1l	UTSW	3	97582731	missense	probably benign	0.01
R1500:Chd1l	UTSW	3	97582805	missense	probably benign	0.01
R1619:Chd1l	UTSW	3	97582731	missense	probably benign	0.01
R1640:Chd1l	UTSW	3	97580991	missense	probably benign	0.00
R1762:Chd1l	UTSW	3	97588299	missense	probably damaging	1.00
R2291:Chd1l	UTSW	3	97591283	missense	probably damaging	1.00
R2444:Chd1l	UTSW	3	97590566	missense	probably damaging	1.00
R4008:Chd1l	UTSW	3	97570402	missense	probably benign	0.01
R4011:Chd1l	UTSW	3	97570402	missense	probably benign	0.01
R4106:Chd1l	UTSW	3	97597703	missense	probably benign	0.09
R4857:Chd1l	UTSW	3	97572659	missense	probably benign	0.27
R5008:Chd1l	UTSW	3	97583908	missense	probably damaging	1.00
R5337:Chd1l	UTSW	3	97562616	missense	probably damaging	1.00
R5844:Chd1l	UTSW	3	97572567	missense	probably benign	0.04
R6283:Chd1l	UTSW	3	97587167	missense	probably damaging	1.00
R6298:Chd1l	UTSW	3	97587167	missense	probably damaging	1.00
R6309:Chd1l	UTSW	3	97587167	missense	probably damaging	1.00
R6311:Chd1l	UTSW	3	97587167	missense	probably damaging	1.00
R6321:Chd1l	UTSW	3	97587167	missense	probably damaging	1.00
R6327:Chd1l	UTSW	3	97587167	missense	probably damaging	1.00
R6364:Chd1l	UTSW	3	97587167	missense	probably damaging	1.00
R6366:Chd1l	UTSW	3	97594160	missense	probably benign	0.00
R6467:Chd1l	UTSW	3	97563533	missense	probably damaging	0.97
R6483:Chd1l	UTSW	3	97587167	missense	probably damaging	1.00
R6493:Chd1l	UTSW	3	97587167	missense	probably damaging	1.00
R6494:Chd1l	UTSW	3	97587167	missense	probably damaging	1.00
R6925:Chd1l	UTSW	3	97582826	missense	probably damaging	1.00
R7148:Chd1l	UTSW	3	97591316	missense	probably damaging	1.00
R7244:Chd1l	UTSW	3	97597750	missense	probably damaging	1.00
R8111:Chd1l	UTSW	3	97587210	missense	possibly damaging	0.95
R8346:Chd1l	UTSW	3	97562643	missense	probably benign	0.06
R8852:Chd1l	UTSW	3	97570369	missense	probably benign	0.00
R8860:Chd1l	UTSW	3	97570369	missense	probably benign	0.00
R9164:Chd1l	UTSW	3	97594040	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCCATTACACCATTACCGGC -3'
(R):5'- ACACACAGAGTTCCAAGTTCAG -3'

Sequencing Primer
(F):5'- CATGCATGATCCCTCAATGGTAGG -3'
(R):5'- CGCCATCTTTTCTGTCTTGGGG -3'

Posted On

2018-06-22