Incidental Mutation 'R6585:Chd1l'
ID524322
Institutional Source Beutler Lab
Gene Symbol Chd1l
Ensembl Gene ENSMUSG00000028089
Gene Namechromodomain helicase DNA binding protein 1-like
Synonyms4432404A22Rik, Snf2p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location97560742-97610203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97597772 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 160 (F160L)
Ref Sequence ENSEMBL: ENSMUSP00000029730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029730]
Predicted Effect probably damaging
Transcript: ENSMUST00000029730
AA Change: F160L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029730
Gene: ENSMUSG00000028089
AA Change: F160L

DomainStartEndE-ValueType
DEXDc 36 224 1.83e-38 SMART
HELICc 371 453 7.45e-21 SMART
low complexity region 548 570 N/A INTRINSIC
coiled coil region 643 680 N/A INTRINSIC
low complexity region 692 709 N/A INTRINSIC
PDB:2FG1|A 718 878 6e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197304
Meta Mutation Damage Score 0.4420 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase protein involved in DNA repair. The protein converts ATP to add poly(ADP-ribose) as it regulates chromatin relaxation following DNA damage. Overexpression of this gene has been linked to several types of cancers. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Chd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Chd1l APN 3 97590605 missense probably damaging 1.00
IGL01349:Chd1l APN 3 97591234 missense probably benign 0.07
IGL02115:Chd1l APN 3 97589904 critical splice donor site probably null
IGL02418:Chd1l APN 3 97581099 missense probably benign 0.39
IGL02717:Chd1l APN 3 97583907 missense probably damaging 1.00
IGL03091:Chd1l APN 3 97563547 missense probably damaging 1.00
IGL03048:Chd1l UTSW 3 97597763 missense probably benign 0.01
R0125:Chd1l UTSW 3 97587149 missense probably benign 0.00
R0702:Chd1l UTSW 3 97566794 missense probably benign 0.05
R1226:Chd1l UTSW 3 97562625 nonsense probably null
R1237:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1238:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1239:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1301:Chd1l UTSW 3 97603648 splice site probably benign
R1366:Chd1l UTSW 3 97581149 missense probably damaging 0.99
R1444:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1445:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1500:Chd1l UTSW 3 97582805 missense probably benign 0.01
R1619:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1640:Chd1l UTSW 3 97580991 missense probably benign 0.00
R1762:Chd1l UTSW 3 97588299 missense probably damaging 1.00
R2291:Chd1l UTSW 3 97591283 missense probably damaging 1.00
R2444:Chd1l UTSW 3 97590566 missense probably damaging 1.00
R4008:Chd1l UTSW 3 97570402 missense probably benign 0.01
R4011:Chd1l UTSW 3 97570402 missense probably benign 0.01
R4106:Chd1l UTSW 3 97597703 missense probably benign 0.09
R4857:Chd1l UTSW 3 97572659 missense probably benign 0.27
R5008:Chd1l UTSW 3 97583908 missense probably damaging 1.00
R5337:Chd1l UTSW 3 97562616 missense probably damaging 1.00
R5844:Chd1l UTSW 3 97572567 missense probably benign 0.04
R6283:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6298:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6309:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6311:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6321:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6327:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6364:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6366:Chd1l UTSW 3 97594160 missense probably benign 0.00
R6467:Chd1l UTSW 3 97563533 missense probably damaging 0.97
R6483:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6493:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6494:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6925:Chd1l UTSW 3 97582826 missense probably damaging 1.00
R7148:Chd1l UTSW 3 97591316 missense probably damaging 1.00
R7244:Chd1l UTSW 3 97597750 missense probably damaging 1.00
R8111:Chd1l UTSW 3 97587210 missense possibly damaging 0.95
R8346:Chd1l UTSW 3 97562643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCATTACACCATTACCGGC -3'
(R):5'- ACACACAGAGTTCCAAGTTCAG -3'

Sequencing Primer
(F):5'- CATGCATGATCCCTCAATGGTAGG -3'
(R):5'- CGCCATCTTTTCTGTCTTGGGG -3'
Posted On2018-06-22