Incidental Mutation 'R6585:Olfr273'
List |< first << previous [record 20 of 31] next >> last >|
ID524324
Institutional Source Beutler Lab
Gene Symbol Olfr273
Ensembl Gene ENSMUSG00000049648
Gene Nameolfactory receptor 273
SynonymsGA_x6K02T2N78B-7137430-7138383, MOR262-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location52852154-52859236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52856192 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 107 (M107K)
Ref Sequence ENSEMBL: ENSMUSP00000103297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051520] [ENSMUST00000107670] [ENSMUST00000215274]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051520
AA Change: M107K

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052080
Gene: ENSMUSG00000049648
AA Change: M107K

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.3e-55 PFAM
Pfam:7tm_1 41 296 1.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107670
AA Change: M107K

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103297
Gene: ENSMUSG00000049648
AA Change: M107K

DomainStartEndE-ValueType
Pfam:7tm_1 41 296 3.2e-37 PFAM
Pfam:7tm_4 139 289 4e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215274
AA Change: M107K

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Olfr273
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Olfr273 APN 4 52856144 missense probably damaging 1.00
R0048:Olfr273 UTSW 4 52856196 missense probably damaging 1.00
R0048:Olfr273 UTSW 4 52856196 missense probably damaging 1.00
R0826:Olfr273 UTSW 4 52855566 missense probably benign
R0831:Olfr273 UTSW 4 52855764 missense possibly damaging 0.46
R1772:Olfr273 UTSW 4 52855730 missense probably benign 0.30
R1774:Olfr273 UTSW 4 52855674 missense probably benign 0.01
R1861:Olfr273 UTSW 4 52856373 missense probably benign 0.00
R2080:Olfr273 UTSW 4 52855568 missense probably benign 0.20
R2242:Olfr273 UTSW 4 52855769 missense probably damaging 1.00
R3777:Olfr273 UTSW 4 52855636 missense probably damaging 1.00
R4492:Olfr273 UTSW 4 52855764 missense probably benign 0.01
R4748:Olfr273 UTSW 4 52856076 missense possibly damaging 0.95
R4880:Olfr273 UTSW 4 52856411 missense probably damaging 1.00
R4905:Olfr273 UTSW 4 52855613 missense probably damaging 0.99
R5856:Olfr273 UTSW 4 52856516 start gained probably benign
R6862:Olfr273 UTSW 4 52855695 missense probably benign
R7378:Olfr273 UTSW 4 52856421 missense probably benign
R7649:Olfr273 UTSW 4 52855692 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTATTCCCACAGAAAGGCAGCC -3'
(R):5'- TAACTGGCAATGGTGTTCTGATC -3'

Sequencing Primer
(F):5'- CCGCATGGCAAGGGATGTTTG -3'
(R):5'- GGTGTTCTGATCATAGCAAGCATC -3'
Posted On2018-06-22