Incidental Mutation 'R6585:Pramef20'
ID 524325
Institutional Source Beutler Lab
Gene Symbol Pramef20
Ensembl Gene ENSMUSG00000073721
Gene Name PRAME family member 20
Synonyms Gm13125, EG627009
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6585 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 144372760-144377933 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 144377030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 175 (L175F)
Ref Sequence ENSEMBL: ENSMUSP00000112488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121109]
AlphaFold B1ARV6
Predicted Effect possibly damaging
Transcript: ENSMUST00000121109
AA Change: L175F

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112488
Gene: ENSMUSG00000073721
AA Change: L175F

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 409 1e-11 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Pramef20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Pramef20 APN 4 144377133 missense probably benign 0.01
IGL01516:Pramef20 APN 4 144377767 missense probably damaging 1.00
IGL02655:Pramef20 APN 4 144372846 missense probably benign 0.05
IGL02983:Pramef20 APN 4 144373127 missense probably benign 0.24
R0201:Pramef20 UTSW 4 144377273 splice site probably benign
R1882:Pramef20 UTSW 4 144376915 missense probably benign 0.03
R4440:Pramef20 UTSW 4 144372867 missense probably benign
R4805:Pramef20 UTSW 4 144377020 missense probably benign 0.08
R4823:Pramef20 UTSW 4 144373211 missense possibly damaging 0.81
R4925:Pramef20 UTSW 4 144377932 start codon destroyed probably null 1.00
R5024:Pramef20 UTSW 4 144373308 nonsense probably null
R5472:Pramef20 UTSW 4 144377157 missense probably benign 0.00
R6133:Pramef20 UTSW 4 144377777 missense possibly damaging 0.81
R6495:Pramef20 UTSW 4 144376839 missense probably benign 0.43
R6732:Pramef20 UTSW 4 144373173 missense probably benign 0.20
R7048:Pramef20 UTSW 4 144377184 missense probably benign 0.15
R7165:Pramef20 UTSW 4 144372819 missense probably damaging 0.97
R7469:Pramef20 UTSW 4 144373103 missense probably damaging 1.00
R8873:Pramef20 UTSW 4 144373301 missense probably benign 0.43
R8891:Pramef20 UTSW 4 144372827 missense probably damaging 0.99
R8909:Pramef20 UTSW 4 144376983 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGAGAGAGCAAGTTTACGC -3'
(R):5'- GATTTACGGTCTGTGGGACAAAAC -3'

Sequencing Primer
(F):5'- CAAGTTCCTCATTTGGCGCAAG -3'
(R):5'- AAAACTATTTGAATGTGTGGCCTGG -3'
Posted On 2018-06-22