Incidental Mutation 'R6585:Pramef20'
List |< first << previous [record 23 of 31] next >> last >|
ID524325
Institutional Source Beutler Lab
Gene Symbol Pramef20
Ensembl Gene ENSMUSG00000073721
Gene NamePRAME family member 20
SynonymsGm13125, EG627009
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location144372760-144377933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 144377030 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 175 (L175F)
Ref Sequence ENSEMBL: ENSMUSP00000112488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121109]
Predicted Effect possibly damaging
Transcript: ENSMUST00000121109
AA Change: L175F

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112488
Gene: ENSMUSG00000073721
AA Change: L175F

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 409 1e-11 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Pramef20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Pramef20 APN 4 144377133 missense probably benign 0.01
IGL01516:Pramef20 APN 4 144377767 missense probably damaging 1.00
IGL02655:Pramef20 APN 4 144372846 missense probably benign 0.05
IGL02983:Pramef20 APN 4 144373127 missense probably benign 0.24
R0201:Pramef20 UTSW 4 144377273 splice site probably benign
R1882:Pramef20 UTSW 4 144376915 missense probably benign 0.03
R4440:Pramef20 UTSW 4 144372867 missense probably benign
R4805:Pramef20 UTSW 4 144377020 missense probably benign 0.08
R4823:Pramef20 UTSW 4 144373211 missense possibly damaging 0.81
R4925:Pramef20 UTSW 4 144377932 start codon destroyed probably null 1.00
R5024:Pramef20 UTSW 4 144373308 nonsense probably null
R5472:Pramef20 UTSW 4 144377157 missense probably benign 0.00
R6133:Pramef20 UTSW 4 144377777 missense possibly damaging 0.81
R6495:Pramef20 UTSW 4 144376839 missense probably benign 0.43
R6732:Pramef20 UTSW 4 144373173 missense probably benign 0.20
R7048:Pramef20 UTSW 4 144377184 missense probably benign 0.15
R7165:Pramef20 UTSW 4 144372819 missense probably damaging 0.97
R7469:Pramef20 UTSW 4 144373103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGAGAGCAAGTTTACGC -3'
(R):5'- GATTTACGGTCTGTGGGACAAAAC -3'

Sequencing Primer
(F):5'- CAAGTTCCTCATTTGGCGCAAG -3'
(R):5'- AAAACTATTTGAATGTGTGGCCTGG -3'
Posted On2018-06-22