Mutagenetix > Incidental Mutation

Incidental Mutation 'R6585:Park7'

524327

Institutional Source

Beutler Lab

Gene Symbol

Park7

Ensembl Gene

ENSMUSG00000028964

Gene Name

Parkinson disease (autosomal recessive, early onset) 7

Synonyms

DJ-1

MMRRC Submission

044709-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.449) question?

Stock #

R6585 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

150981590-150994378 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 150989721 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 80 (Q80K)

Ref Sequence

ENSEMBL: ENSMUSP00000101301 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030805] [ENSMUST00000105673] [ENSMUST00000105674] [ENSMUST00000105675] [ENSMUST00000105676] [ENSMUST00000128075] [ENSMUST00000134751] [ENSMUST00000146184]

AlphaFold

Q99LX0

Predicted Effect

probably benign
Transcript: ENSMUST00000030805
AA Change: Q80K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000030805
Gene: ENSMUSG00000028964
AA Change: Q80K

Domain	Start	End	E-Value	Type
Pfam:DUF4066	9	170	1.4e-17	PFAM
Pfam:DJ-1_PfpI	32	173	8.3e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105673
AA Change: Q80K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000101298
Gene: ENSMUSG00000028964
AA Change: Q80K

Domain	Start	End	E-Value	Type
Pfam:DUF4066	9	170	1.4e-17	PFAM
Pfam:DJ-1_PfpI	32	173	8.3e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105674
AA Change: Q80K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000101299
Gene: ENSMUSG00000028964
AA Change: Q80K

Domain	Start	End	E-Value	Type
Pfam:DJ-1_PfpI	4	171	1.2e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105675
AA Change: Q80K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000101300
Gene: ENSMUSG00000028964
AA Change: Q80K

Domain	Start	End	E-Value	Type
Pfam:DUF4066	9	170	1.4e-17	PFAM
Pfam:DJ-1_PfpI	32	173	8.3e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105676
AA Change: Q80K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000101301
Gene: ENSMUSG00000028964
AA Change: Q80K

Domain	Start	End	E-Value	Type
Pfam:DUF4066	9	170	1.7e-16	PFAM
Pfam:DJ-1_PfpI	32	171	3.6e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128075
AA Change: Q80K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000115875
Gene: ENSMUSG00000028964
AA Change: Q80K

Domain	Start	End	E-Value	Type
Pfam:DUF4066	9	135	1.1e-15	PFAM
Pfam:DJ-1_PfpI	32	136	1.2e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132265

Predicted Effect

probably benign
Transcript: ENSMUST00000134751
AA Change: Q80K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000122265
Gene: ENSMUSG00000028964
AA Change: Q80K

Domain	Start	End	E-Value	Type
Pfam:DJ-1_PfpI	32	114	6.1e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146184
AA Change: Q80K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000120832
Gene: ENSMUSG00000028964
AA Change: Q80K

Domain	Start	End	E-Value	Type
Pfam:DJ-1_PfpI	32	84	4e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148626

Meta Mutation Damage Score

0.1413

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced evoked dopamine overflow in the striatum, resulting primarily from increased dopamine uptake. Mice show hyopactivity, absent long-term depression in medium spiny neurons and decreased sensitivity of nigral neurons to dopamine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,885,534 (GRCm39)	C108Y	probably damaging	Het
Adam1b	G	T	5: 121,639,250 (GRCm39)	D598E	probably benign	Het
Agr2	G	A	12: 36,045,625 (GRCm39)	R37Q	probably benign	Het
Ascc3	A	G	10: 50,718,273 (GRCm39)	K1989E	probably benign	Het
Chd1l	A	G	3: 97,505,088 (GRCm39)	F160L	probably damaging	Het
Ciita	T	A	16: 10,329,609 (GRCm39)	V628E	probably benign	Het
Defa38	A	G	8: 21,585,248 (GRCm39)	C65R	possibly damaging	Het
Dis3l2	T	A	1: 86,673,216 (GRCm39)	I69N	probably damaging	Het
Dnase1l1	C	T	X: 73,320,644 (GRCm39)		probably null	Homo
Elp2	T	C	18: 24,758,606 (GRCm39)	L503S	probably damaging	Het
Fcgbp	A	T	7: 27,813,404 (GRCm39)	Q2313L	possibly damaging	Het
Gpr155	A	T	2: 73,179,989 (GRCm39)	I157N	probably damaging	Het
H2bc18	A	T	3: 96,177,413 (GRCm39)	T116S	probably benign	Het
Kcnj1	T	C	9: 32,308,557 (GRCm39)	V307A	probably benign	Het
Lama3	G	A	18: 12,552,314 (GRCm39)		probably null	Het
Lrp6	A	T	6: 134,484,521 (GRCm39)	Y367*	probably null	Het
Ms4a14	T	A	19: 11,281,009 (GRCm39)	Q516H	unknown	Het
Nprl3	C	T	11: 32,184,812 (GRCm39)	R399Q	probably benign	Het
Or13c3	A	T	4: 52,856,192 (GRCm39)	M107K	possibly damaging	Het
Or5ae1	A	T	7: 84,565,670 (GRCm39)	I228F	probably damaging	Het
Pramel15	C	A	4: 144,103,600 (GRCm39)	L175F	possibly damaging	Het
Pramel52-ps	C	T	5: 94,529,415 (GRCm39)	P62S	probably benign	Het
Ptgs2	T	C	1: 149,979,738 (GRCm39)	V281A	possibly damaging	Het
Rprd1a	T	C	18: 24,639,720 (GRCm39)		probably null	Het
Speer4f2	A	G	5: 17,579,420 (GRCm39)	E73G	probably damaging	Het
Spta1	T	C	1: 174,006,251 (GRCm39)	W138R	probably damaging	Het
U2surp	T	C	9: 95,354,124 (GRCm39)	E838G	probably damaging	Het
Urb2	G	T	8: 124,757,864 (GRCm39)	E1190D	probably damaging	Het
Usp19	G	T	9: 108,376,926 (GRCm39)	L1165F	probably damaging	Het
Zfp27	G	A	7: 29,595,818 (GRCm39)	T49I	possibly damaging	Het

Other mutations in Park7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02137:Park7	APN	4	150,988,288 (GRCm39)	missense	probably benign	0.28
stiffed	UTSW	4	150,991,547 (GRCm39)	missense	possibly damaging	0.82
usurped	UTSW	4	150,988,341 (GRCm39)	missense	probably damaging	1.00
R0268:Park7	UTSW	4	150,992,806 (GRCm39)	missense	possibly damaging	0.94
R0344:Park7	UTSW	4	150,992,806 (GRCm39)	missense	possibly damaging	0.94
R2062:Park7	UTSW	4	150,989,732 (GRCm39)	missense	probably benign	0.05
R2416:Park7	UTSW	4	150,992,858 (GRCm39)	missense	probably benign	0.01
R3032:Park7	UTSW	4	150,985,509 (GRCm39)	missense	probably benign	0.00
R4638:Park7	UTSW	4	150,991,556 (GRCm39)	nonsense	probably null
R5345:Park7	UTSW	4	150,992,880 (GRCm39)	splice site	probably benign
R7957:Park7	UTSW	4	150,988,341 (GRCm39)	missense	probably damaging	1.00
R8155:Park7	UTSW	4	150,991,547 (GRCm39)	missense	possibly damaging	0.82
R9337:Park7	UTSW	4	150,991,553 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGCAGCGTGAGACACTC -3'
(R):5'- CCAGAGGGATACACCTTTATTTATCTG -3'

Sequencing Primer
(F):5'- GAGACACTCACTGCCAACCTCTG -3'
(R):5'- GGTGTGCACTACTATGACTAGCAC -3'

Posted On

2018-06-22