Incidental Mutation 'R6585:Park7'
List |< first << previous [record 22 of 31] next >> last >|
ID524327
Institutional Source Beutler Lab
Gene Symbol Park7
Ensembl Gene ENSMUSG00000028964
Gene NameParkinson disease (autosomal recessive, early onset) 7
SynonymsDJ-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location150897133-150914437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 150905264 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 80 (Q80K)
Ref Sequence ENSEMBL: ENSMUSP00000101301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030805] [ENSMUST00000105673] [ENSMUST00000105674] [ENSMUST00000105675] [ENSMUST00000105676] [ENSMUST00000128075] [ENSMUST00000134751] [ENSMUST00000146184]
Predicted Effect probably benign
Transcript: ENSMUST00000030805
AA Change: Q80K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030805
Gene: ENSMUSG00000028964
AA Change: Q80K

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105673
AA Change: Q80K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101298
Gene: ENSMUSG00000028964
AA Change: Q80K

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105674
AA Change: Q80K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101299
Gene: ENSMUSG00000028964
AA Change: Q80K

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 4 171 1.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105675
AA Change: Q80K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101300
Gene: ENSMUSG00000028964
AA Change: Q80K

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105676
AA Change: Q80K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101301
Gene: ENSMUSG00000028964
AA Change: Q80K

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.7e-16 PFAM
Pfam:DJ-1_PfpI 32 171 3.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128075
AA Change: Q80K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000115875
Gene: ENSMUSG00000028964
AA Change: Q80K

DomainStartEndE-ValueType
Pfam:DUF4066 9 135 1.1e-15 PFAM
Pfam:DJ-1_PfpI 32 136 1.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132265
Predicted Effect probably benign
Transcript: ENSMUST00000134751
AA Change: Q80K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000122265
Gene: ENSMUSG00000028964
AA Change: Q80K

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 114 6.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146184
AA Change: Q80K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120832
Gene: ENSMUSG00000028964
AA Change: Q80K

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 84 4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148626
Meta Mutation Damage Score 0.1413 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced evoked dopamine overflow in the striatum, resulting primarily from increased dopamine uptake. Mice show hyopactivity, absent long-term depression in medium spiny neurons and decreased sensitivity of nigral neurons to dopamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Park7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Park7 APN 4 150903831 missense probably benign 0.28
stiffed UTSW 4 150907090 missense possibly damaging 0.82
R0268:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R0344:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R2062:Park7 UTSW 4 150905275 missense probably benign 0.05
R2416:Park7 UTSW 4 150908401 missense probably benign 0.01
R3032:Park7 UTSW 4 150901052 missense probably benign 0.00
R4638:Park7 UTSW 4 150907099 nonsense probably null
R5345:Park7 UTSW 4 150908423 splice site probably benign
R7957:Park7 UTSW 4 150903884 missense probably damaging 1.00
R8155:Park7 UTSW 4 150907090 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCTGCAGCGTGAGACACTC -3'
(R):5'- CCAGAGGGATACACCTTTATTTATCTG -3'

Sequencing Primer
(F):5'- GAGACACTCACTGCCAACCTCTG -3'
(R):5'- GGTGTGCACTACTATGACTAGCAC -3'
Posted On2018-06-22