Mutagenetix > Incidental Mutations

Incidental Mutation 'R6585:Speer4f2'

524329

Institutional Source

Beutler Lab

Gene Symbol

Speer4f2

Ensembl Gene

ENSMUSG00000091827

Gene Name

spermatogenesis associated glutamate (E)-rich protein 4f2

Synonyms

Gm3535, Gm3495

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R6585 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

17373180-17378028 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17374422 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 73 (E73G)

Ref Sequence

ENSEMBL: ENSMUSP00000129818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166086]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166086
AA Change: E73G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129818
Gene: ENSMUSG00000091827
AA Change: E73G

Domain	Start	End	E-Value	Type
Pfam:Takusan	34	112	9.6e-20	PFAM
low complexity region	208	253	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

97% (30/31)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,737,668	C108Y	probably damaging	Het
AA792892	C	T	5: 94,381,556	P62S	probably benign	Het
Adam1b	G	T	5: 121,501,187	D598E	probably benign	Het
Agr2	G	A	12: 35,995,626	R37Q	probably benign	Het
Ascc3	A	G	10: 50,842,177	K1989E	probably benign	Het
Chd1l	A	G	3: 97,597,772	F160L	probably damaging	Het
Ciita	T	A	16: 10,511,745	V628E	probably benign	Het
Dis3l2	T	A	1: 86,745,494	I69N	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Elp2	T	C	18: 24,625,549	L503S	probably damaging	Het
Fcgbp	A	T	7: 28,113,979	Q2313L	possibly damaging	Het
Gm14851	A	G	8: 21,095,232	C65R	possibly damaging	Het
Gpr155	A	T	2: 73,349,645	I157N	probably damaging	Het
Hist2h2bb	A	T	3: 96,270,097	T116S	probably benign	Het
Kcnj1	T	C	9: 32,397,261	V307A	probably benign	Het
Lama3	G	A	18: 12,419,257		probably null	Het
Lrp6	A	T	6: 134,507,558	Y367*	probably null	Het
Ms4a14	T	A	19: 11,303,645	Q516H	unknown	Het
Nprl3	C	T	11: 32,234,812	R399Q	probably benign	Het
Olfr273	A	T	4: 52,856,192	M107K	possibly damaging	Het
Olfr290	A	T	7: 84,916,462	I228F	probably damaging	Het
Park7	G	T	4: 150,905,264	Q80K	probably benign	Het
Pramef20	C	A	4: 144,377,030	L175F	possibly damaging	Het
Ptgs2	T	C	1: 150,103,987	V281A	possibly damaging	Het
Rprd1a	T	C	18: 24,506,663		probably null	Het
Spta1	T	C	1: 174,178,685	W138R	probably damaging	Het
U2surp	T	C	9: 95,472,071	E838G	probably damaging	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp19	G	T	9: 108,499,727	L1165F	probably damaging	Het
Zfp27	G	A	7: 29,896,393	T49I	possibly damaging	Het

Other mutations in Speer4f2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01505:Speer4f2	APN	5	17376567	missense	possibly damaging	0.94
IGL02092:Speer4f2	APN	5	17376629	nonsense	probably null
IGL03100:Speer4f2	APN	5	17376530	missense	probably damaging	0.99
R0939:Speer4f2	UTSW	5	17374404	missense	probably damaging	0.99
R1384:Speer4f2	UTSW	5	17374449	missense	probably damaging	1.00
R1528:Speer4f2	UTSW	5	17376542	missense
R1873:Speer4f2	UTSW	5	17374449	missense	probably damaging	1.00
R3608:Speer4f2	UTSW	5	17374494	missense	probably benign	0.03
R4972:Speer4f2	UTSW	5	17374425	missense	probably benign	0.27
R5421:Speer4f2	UTSW	5	17374358	missense	possibly damaging	0.88
R5450:Speer4f2	UTSW	5	17373219	missense	possibly damaging	0.85
R5452:Speer4f2	UTSW	5	17376500	missense	possibly damaging	0.93
R5531:Speer4f2	UTSW	5	17376528	missense	possibly damaging	0.57
R5924:Speer4f2	UTSW	5	17376624	missense	probably damaging	1.00
R6454:Speer4f2	UTSW	5	17374433	missense	probably damaging	0.99
R6553:Speer4f2	UTSW	5	17374422	missense	probably damaging	1.00
R6649:Speer4f2	UTSW	5	17375769	missense	probably benign	0.05
R6878:Speer4f2	UTSW	5	17375767	missense	probably damaging	0.99
R7089:Speer4f2	UTSW	5	17376663	missense
R7129:Speer4f2	UTSW	5	17377448	missense
R7448:Speer4f2	UTSW	5	17376542	missense
R7654:Speer4f2	UTSW	5	17374415	missense
R7942:Speer4f2	UTSW	5	17377632	missense	unknown
R8170:Speer4f2	UTSW	5	17374461	missense

Predicted Primers

PCR Primer
(F):5'- GAAATCTCATACTGGGACCAATCTC -3'
(R):5'- AATGGGGCCCAGGTATGTTC -3'

Sequencing Primer
(F):5'- CCAATCTCTTGGTGGTGTCATTAG -3'
(R):5'- CCCAGGTATGTTCTCATGGTATAGC -3'

Posted On

2018-06-22