Incidental Mutation 'R6585:AA792892'
List |< first << previous [record 2 of 31] next >> last >|
ID524331
Institutional Source Beutler Lab
Gene Symbol AA792892
Ensembl Gene ENSMUSG00000073497
Gene Nameexpressed sequence AA792892
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6585 (G1)
Quality Score85.0076
Status Not validated
Chromosome5
Chromosomal Location94339749-94385079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94381556 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 62 (P62S)
Ref Sequence ENSEMBL: ENSMUSP00000143886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097477] [ENSMUST00000202253]
Predicted Effect probably benign
Transcript: ENSMUST00000097477
AA Change: P62S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095085
Gene: ENSMUSG00000073497
AA Change: P62S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 88 276 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202253
AA Change: P62S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143886
Gene: ENSMUSG00000073497
AA Change: P62S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 88 276 5e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in AA792892
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1985:AA792892 UTSW 5 94384072 missense probably benign 0.13
R4247:AA792892 UTSW 5 94383587 missense possibly damaging 0.93
R4607:AA792892 UTSW 5 94383528 missense probably benign 0.35
R6186:AA792892 UTSW 5 94383976 missense probably benign 0.28
R6755:AA792892 UTSW 5 94381409 missense probably benign 0.03
R6945:AA792892 UTSW 5 94383631 missense possibly damaging 0.57
R7352:AA792892 UTSW 5 94383884 missense probably damaging 1.00
R7960:AA792892 UTSW 5 94383880 missense probably benign 0.01
R8381:AA792892 UTSW 5 94384022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAACTGCTTCCCCAGGAG -3'
(R):5'- GCATCTGAACCATTTAGTACAAAGCC -3'

Sequencing Primer
(F):5'- TTCTTACTGAAGACCTGAGAGGATG -3'
(R):5'- TTTAGTACAAAGCCAATCTCCCTGG -3'
Posted On2018-06-22