Incidental Mutation 'R6648:Kif21b'
ID524332
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Namekinesin family member 21B
SynonymsN-5 kinesin, 2610511N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6648 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location136131389-136177998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136152397 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 557 (V557A)
Ref Sequence ENSEMBL: ENSMUSP00000114297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]
Predicted Effect probably benign
Transcript: ENSMUST00000075164
AA Change: V557A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: V557A

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122892
Predicted Effect probably benign
Transcript: ENSMUST00000130864
AA Change: V557A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: V557A

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136152342 missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136154094 splice site probably benign
IGL01288:Kif21b APN 1 136172184 missense probably benign 0.00
IGL02105:Kif21b APN 1 136171303 missense probably benign
IGL02264:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02303:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02308:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02310:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02419:Kif21b APN 1 136151267 missense probably benign 0.00
IGL02553:Kif21b APN 1 136154121 missense probably damaging 1.00
IGL02568:Kif21b APN 1 136172867 missense probably damaging 0.96
IGL02657:Kif21b APN 1 136172230 missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136158355 unclassified probably benign
IGL03230:Kif21b APN 1 136162812 missense probably benign 0.03
R0629_Kif21b_729 UTSW 1 136172157 critical splice acceptor site probably null
Schiessen UTSW 1 136147869 critical splice donor site probably null
wolfen UTSW 1 136144758 nonsense probably null
R0190:Kif21b UTSW 1 136171219 missense probably benign 0.32
R0349:Kif21b UTSW 1 136149311 missense probably damaging 0.97
R0501:Kif21b UTSW 1 136163099 missense probably benign 0.44
R0620:Kif21b UTSW 1 136159428 missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136172157 critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136159744 missense probably damaging 1.00
R1087:Kif21b UTSW 1 136162823 missense probably damaging 1.00
R1217:Kif21b UTSW 1 136152376 missense probably damaging 1.00
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136169324 critical splice donor site probably null
R1512:Kif21b UTSW 1 136152805 missense probably benign 0.01
R1513:Kif21b UTSW 1 136156111 missense probably damaging 0.98
R1591:Kif21b UTSW 1 136149317 missense probably damaging 1.00
R1616:Kif21b UTSW 1 136171685 missense probably damaging 1.00
R1628:Kif21b UTSW 1 136171220 missense probably benign 0.01
R1658:Kif21b UTSW 1 136171285 missense probably damaging 1.00
R1728:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136156142 missense probably damaging 1.00
R1784:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1807:Kif21b UTSW 1 136147793 missense possibly damaging 0.94
R1896:Kif21b UTSW 1 136147845 missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136171156 missense probably damaging 1.00
R1984:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1985:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1986:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1988:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R1990:Kif21b UTSW 1 136161770 missense probably damaging 1.00
R2014:Kif21b UTSW 1 136148282 missense probably damaging 1.00
R2045:Kif21b UTSW 1 136160313 missense probably damaging 1.00
R2141:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R2248:Kif21b UTSW 1 136172966 missense probably damaging 1.00
R2886:Kif21b UTSW 1 136147874 splice site probably benign
R2896:Kif21b UTSW 1 136154217 missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136159410 missense probably benign 0.06
R3780:Kif21b UTSW 1 136156226 missense probably damaging 0.99
R3827:Kif21b UTSW 1 136162994 critical splice donor site probably null
R4227:Kif21b UTSW 1 136154093 splice site probably null
R4600:Kif21b UTSW 1 136147864 missense probably benign 0.39
R4608:Kif21b UTSW 1 136148186 intron probably benign
R4749:Kif21b UTSW 1 136144749 nonsense probably null
R4841:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4842:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4933:Kif21b UTSW 1 136151325 splice site probably null
R4959:Kif21b UTSW 1 136148370 missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136172234 missense probably benign 0.30
R5116:Kif21b UTSW 1 136152783 missense probably damaging 0.99
R5119:Kif21b UTSW 1 136163100 missense probably benign
R5197:Kif21b UTSW 1 136144625 missense probably damaging 1.00
R5230:Kif21b UTSW 1 136171673 missense probably damaging 1.00
R5249:Kif21b UTSW 1 136169228 missense probably damaging 1.00
R5337:Kif21b UTSW 1 136171143 missense probably damaging 1.00
R5358:Kif21b UTSW 1 136172292 missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136147525 missense probably damaging 1.00
R5557:Kif21b UTSW 1 136170059 missense probably damaging 1.00
R5727:Kif21b UTSW 1 136170009 missense probably damaging 1.00
R5865:Kif21b UTSW 1 136151137 nonsense probably null
R5929:Kif21b UTSW 1 136151207 missense probably damaging 1.00
R6274:Kif21b UTSW 1 136149418 missense possibly damaging 0.57
R6349:Kif21b UTSW 1 136158326 missense probably damaging 1.00
R6831:Kif21b UTSW 1 136144758 nonsense probably null
R7156:Kif21b UTSW 1 136147824 missense probably damaging 1.00
R7165:Kif21b UTSW 1 136149448 missense probably damaging 0.98
R7327:Kif21b UTSW 1 136159649 missense possibly damaging 0.60
R7680:Kif21b UTSW 1 136147869 critical splice donor site probably null
R7975:Kif21b UTSW 1 136171173 missense probably damaging 1.00
R8356:Kif21b UTSW 1 136172945 missense probably damaging 1.00
R8467:Kif21b UTSW 1 136172283 missense probably damaging 0.98
RF024:Kif21b UTSW 1 136158341 missense probably damaging 1.00
X0053:Kif21b UTSW 1 136149316 missense probably damaging 1.00
X0066:Kif21b UTSW 1 136172945 missense probably damaging 1.00
Z1176:Kif21b UTSW 1 136154137 missense probably benign 0.00
Z1177:Kif21b UTSW 1 136148312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGAGGCTATGAATGAGTCC -3'
(R):5'- AAGGCTGGAGAAGGTACCTTTC -3'

Sequencing Primer
(F):5'- TATGAATGAGTCCCTCCGCAG -3'
(R):5'- GGAGAAGGTACCTTTCCTCCAAATTG -3'
Posted On2018-06-22