Incidental Mutation 'R6585:4930522L14Rik'
ID 524333
Institutional Source Beutler Lab
Gene Symbol 4930522L14Rik
Ensembl Gene ENSMUSG00000072762
Gene Name RIKEN cDNA 4930522L14 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R6585 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 109735990-109751886 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 109737668 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 108 (C108Y)
Ref Sequence ENSEMBL: ENSMUSP00000108166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100937] [ENSMUST00000112547]
AlphaFold E9QAG4
Predicted Effect probably benign
Transcript: ENSMUST00000100937
SMART Domains Protein: ENSMUSP00000098497
Gene: ENSMUSG00000072762

DomainStartEndE-ValueType
KRAB 4 64 5.37e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112547
AA Change: C108Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108166
Gene: ENSMUSG00000072762
AA Change: C108Y

DomainStartEndE-ValueType
KRAB 4 66 7.19e-16 SMART
ZnF_C2H2 103 125 2.75e-3 SMART
ZnF_C2H2 131 153 1.72e-4 SMART
ZnF_C2H2 159 181 7.9e-4 SMART
ZnF_C2H2 187 209 1.04e-3 SMART
ZnF_C2H2 215 237 1.1e-2 SMART
ZnF_C2H2 243 265 3.89e-3 SMART
ZnF_C2H2 271 294 3.69e-4 SMART
ZnF_C2H2 300 322 5.9e-3 SMART
ZnF_C2H2 328 350 1.56e-2 SMART
ZnF_C2H2 356 378 1.18e-2 SMART
ZnF_C2H2 384 406 9.08e-4 SMART
ZnF_C2H2 412 434 1.98e-4 SMART
ZnF_C2H2 440 462 2.61e-4 SMART
ZnF_C2H2 468 491 1.38e-3 SMART
ZnF_C2H2 497 519 3.39e-3 SMART
ZnF_C2H2 525 547 1.4e-4 SMART
ZnF_C2H2 553 576 1.95e-3 SMART
ZnF_C2H2 582 604 5.14e-3 SMART
ZnF_C2H2 610 632 1.67e-2 SMART
ZnF_C2H2 638 660 1.72e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in 4930522L14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02622:4930522L14Rik APN 5 109739235 missense possibly damaging 0.86
R0164:4930522L14Rik UTSW 5 109736847 missense probably damaging 0.96
R0164:4930522L14Rik UTSW 5 109736847 missense probably damaging 0.96
R0432:4930522L14Rik UTSW 5 109736919 missense probably damaging 1.00
R0463:4930522L14Rik UTSW 5 109737060 unclassified probably benign
R0891:4930522L14Rik UTSW 5 109736290 missense possibly damaging 0.47
R1289:4930522L14Rik UTSW 5 109736890 nonsense probably null
R1637:4930522L14Rik UTSW 5 109738992 missense probably benign 0.01
R1764:4930522L14Rik UTSW 5 109736789 missense probably benign 0.22
R1793:4930522L14Rik UTSW 5 109736278 missense probably damaging 1.00
R1860:4930522L14Rik UTSW 5 109736232 missense probably damaging 1.00
R1899:4930522L14Rik UTSW 5 109736798 missense probably benign 0.04
R2135:4930522L14Rik UTSW 5 109737643 missense probably benign 0.00
R2143:4930522L14Rik UTSW 5 109736750 missense probably damaging 1.00
R2877:4930522L14Rik UTSW 5 109738945 splice site probably benign
R3847:4930522L14Rik UTSW 5 109736324 splice site probably null
R4431:4930522L14Rik UTSW 5 109736574 missense possibly damaging 0.47
R4578:4930522L14Rik UTSW 5 109736671 nonsense probably null
R4611:4930522L14Rik UTSW 5 109737393 missense probably benign 0.00
R4776:4930522L14Rik UTSW 5 109736873 missense probably benign 0.22
R4921:4930522L14Rik UTSW 5 109737796 missense probably benign 0.25
R4937:4930522L14Rik UTSW 5 109736201 missense probably benign 0.12
R4952:4930522L14Rik UTSW 5 109739197 critical splice donor site probably null
R4980:4930522L14Rik UTSW 5 109737426 missense probably damaging 1.00
R5079:4930522L14Rik UTSW 5 109737330 missense probably benign
R5088:4930522L14Rik UTSW 5 109736073 missense probably damaging 1.00
R5143:4930522L14Rik UTSW 5 109739198 critical splice donor site probably null
R5183:4930522L14Rik UTSW 5 109739305 missense probably damaging 1.00
R5461:4930522L14Rik UTSW 5 109736777 missense possibly damaging 0.74
R5498:4930522L14Rik UTSW 5 109737547 missense probably benign 0.05
R5576:4930522L14Rik UTSW 5 109737704 missense probably benign 0.00
R6081:4930522L14Rik UTSW 5 109739231 missense probably damaging 1.00
R6387:4930522L14Rik UTSW 5 109737015 missense possibly damaging 0.88
R6509:4930522L14Rik UTSW 5 109737384 nonsense probably null
R7309:4930522L14Rik UTSW 5 109736953 missense probably damaging 1.00
R7740:4930522L14Rik UTSW 5 109737504 nonsense probably null
R7877:4930522L14Rik UTSW 5 109736364 missense probably damaging 1.00
R8526:4930522L14Rik UTSW 5 109737789 missense possibly damaging 0.92
R8884:4930522L14Rik UTSW 5 109737488 missense probably damaging 0.98
R9047:4930522L14Rik UTSW 5 109737554 missense
R9432:4930522L14Rik UTSW 5 109737051 missense unknown
Predicted Primers PCR Primer
(F):5'- CATAGGGTTTGTGTTCAGTATGCA -3'
(R):5'- AGAAGGATTCTATAAATGTGAGCCAT -3'

Sequencing Primer
(F):5'- GCATTCGAAGATTACCAGGGTATAC -3'
(R):5'- GTGAGCCATGTAATAACACTCTTACC -3'
Posted On 2018-06-22