Mutagenetix > Incidental Mutations

Incidental Mutation 'R6585:Lrp6'

524336

Institutional Source

Beutler Lab

Gene Symbol

Lrp6

Ensembl Gene

ENSMUSG00000030201

Gene Name

low density lipoprotein receptor-related protein 6

Synonyms

skax26, Cd, ska26, ska

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R6585 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

134446476-134566965 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 134507558 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 367 (Y367*)

Ref Sequence

ENSEMBL: ENSMUSP00000032322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032322] [ENSMUST00000126836]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000032322
AA Change: Y367*

SMART Domains

Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: Y367*

Domain	Start	End	E-Value	Type
LY	43	85	1.55e-2	SMART
LY	87	129	1.91e-11	SMART
LY	130	173	5.19e-13	SMART
LY	174	216	1.39e-13	SMART
LY	217	258	2.87e-6	SMART
EGF	285	324	2.16e-1	SMART
low complexity region	330	341	N/A	INTRINSIC
LY	352	394	1.29e-8	SMART
LY	395	437	5.73e-15	SMART
LY	438	481	1.07e-14	SMART
LY	482	524	3.07e-15	SMART
LY	525	565	4.66e-6	SMART
EGF	591	628	1.47e-3	SMART
LY	654	696	2.06e-7	SMART
LY	697	739	3.73e-14	SMART
LY	740	783	3.37e-12	SMART
LY	784	825	1.17e-6	SMART
LY	827	865	1.91e-2	SMART
EGF	892	930	7.35e-4	SMART
LY	957	999	1.41e-5	SMART
LY	1005	1048	5.32e-1	SMART
LY	1049	1093	5e-6	SMART
LY	1094	1136	4.25e-9	SMART
LY	1137	1177	1.91e-2	SMART
EGF	1206	1250	1.23e1	SMART
LDLa	1248	1287	2.42e-12	SMART
LDLa	1288	1324	4.37e-10	SMART
LDLa	1325	1362	1.66e-10	SMART
transmembrane domain	1371	1393	N/A	INTRINSIC
low complexity region	1429	1438	N/A	INTRINSIC
low complexity region	1444	1457	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1566	1573	N/A	INTRINSIC
low complexity region	1596	1608	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126836

SMART Domains

Protein: ENSMUSP00000144733
Gene: ENSMUSG00000030201

Domain	Start	End	E-Value	Type
LY	23	65	6.8e-16	SMART
LY	66	107	1.4e-8	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,737,668	C108Y	probably damaging	Het
AA792892	C	T	5: 94,381,556	P62S	probably benign	Het
Adam1b	G	T	5: 121,501,187	D598E	probably benign	Het
Agr2	G	A	12: 35,995,626	R37Q	probably benign	Het
Ascc3	A	G	10: 50,842,177	K1989E	probably benign	Het
Chd1l	A	G	3: 97,597,772	F160L	probably damaging	Het
Ciita	T	A	16: 10,511,745	V628E	probably benign	Het
Dis3l2	T	A	1: 86,745,494	I69N	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Elp2	T	C	18: 24,625,549	L503S	probably damaging	Het
Fcgbp	A	T	7: 28,113,979	Q2313L	possibly damaging	Het
Gm14851	A	G	8: 21,095,232	C65R	possibly damaging	Het
Gpr155	A	T	2: 73,349,645	I157N	probably damaging	Het
Hist2h2bb	A	T	3: 96,270,097	T116S	probably benign	Het
Kcnj1	T	C	9: 32,397,261	V307A	probably benign	Het
Lama3	G	A	18: 12,419,257		probably null	Het
Ms4a14	T	A	19: 11,303,645	Q516H	unknown	Het
Nprl3	C	T	11: 32,234,812	R399Q	probably benign	Het
Olfr273	A	T	4: 52,856,192	M107K	possibly damaging	Het
Olfr290	A	T	7: 84,916,462	I228F	probably damaging	Het
Park7	G	T	4: 150,905,264	Q80K	probably benign	Het
Pramef20	C	A	4: 144,377,030	L175F	possibly damaging	Het
Ptgs2	T	C	1: 150,103,987	V281A	possibly damaging	Het
Rprd1a	T	C	18: 24,506,663		probably null	Het
Speer4f2	A	G	5: 17,374,422	E73G	probably damaging	Het
Spta1	T	C	1: 174,178,685	W138R	probably damaging	Het
U2surp	T	C	9: 95,472,071	E838G	probably damaging	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp19	G	T	9: 108,499,727	L1165F	probably damaging	Het
Zfp27	G	A	7: 29,896,393	T49I	possibly damaging	Het

Other mutations in Lrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Lrp6	APN	6	134456090	missense	probably benign	0.17
IGL00765:Lrp6	APN	6	134541854	missense	probably benign	0.02
IGL00898:Lrp6	APN	6	134479739	missense	probably damaging	0.99
IGL00916:Lrp6	APN	6	134484289	missense	probably damaging	1.00
IGL00961:Lrp6	APN	6	134507646	missense	probably damaging	0.98
IGL01620:Lrp6	APN	6	134511262	missense	probably damaging	1.00
IGL01765:Lrp6	APN	6	134456145	missense	probably damaging	0.99
IGL02066:Lrp6	APN	6	134450937	nonsense	probably null
IGL02067:Lrp6	APN	6	134480396	missense	probably damaging	0.99
IGL02169:Lrp6	APN	6	134513327	missense	probably damaging	0.96
IGL02281:Lrp6	APN	6	134457734	missense	probably benign	0.40
IGL02484:Lrp6	APN	6	134541923	missense	probably benign	0.15
IGL02724:Lrp6	APN	6	134484265	missense	probably damaging	1.00
IGL02876:Lrp6	APN	6	134456114	missense	probably benign	0.43
IGL03011:Lrp6	APN	6	134520417	missense	possibly damaging	0.80
IGL03352:Lrp6	APN	6	134479763	missense	probably damaging	1.00
Aileron	UTSW	6	134462616	missense	probably damaging	1.00
Coiled	UTSW	6	134507558	nonsense	probably null
flap	UTSW	6	134486586	missense	probably damaging	0.99
BB004:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
BB014:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
PIT4494001:Lrp6	UTSW	6	134479778	missense	probably damaging	1.00
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0201:Lrp6	UTSW	6	134450897	nonsense	probably null
R0295:Lrp6	UTSW	6	134457693	missense	probably benign	0.02
R0370:Lrp6	UTSW	6	134479766	missense	probably damaging	1.00
R0382:Lrp6	UTSW	6	134467668	missense	probably damaging	1.00
R0413:Lrp6	UTSW	6	134507624	missense	probably damaging	0.99
R0468:Lrp6	UTSW	6	134485661	missense	possibly damaging	0.94
R0492:Lrp6	UTSW	6	134480518	missense	possibly damaging	0.58
R0584:Lrp6	UTSW	6	134456076	missense	probably damaging	0.99
R0631:Lrp6	UTSW	6	134479775	missense	possibly damaging	0.95
R0738:Lrp6	UTSW	6	134542045	missense	probably benign	0.13
R0907:Lrp6	UTSW	6	134507525	missense	probably damaging	0.96
R1273:Lrp6	UTSW	6	134467507	critical splice donor site	probably null
R1548:Lrp6	UTSW	6	134459429	missense	possibly damaging	0.89
R1639:Lrp6	UTSW	6	134453566	missense	possibly damaging	0.68
R1650:Lrp6	UTSW	6	134468769	missense	probably benign	0.01
R1696:Lrp6	UTSW	6	134468723	missense	probably damaging	1.00
R1751:Lrp6	UTSW	6	134464568	missense	probably damaging	1.00
R1780:Lrp6	UTSW	6	134464451	missense	probably damaging	0.99
R2013:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2015:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2165:Lrp6	UTSW	6	134459283	missense	probably damaging	1.00
R2294:Lrp6	UTSW	6	134457742	missense	probably damaging	1.00
R2336:Lrp6	UTSW	6	134507583	missense	probably damaging	0.97
R2964:Lrp6	UTSW	6	134467526	missense	probably damaging	1.00
R3716:Lrp6	UTSW	6	134507447	missense	probably damaging	1.00
R4017:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
R4370:Lrp6	UTSW	6	134506358	nonsense	probably null
R4521:Lrp6	UTSW	6	134485862	missense	probably damaging	1.00
R4573:Lrp6	UTSW	6	134470730	nonsense	probably null
R4645:Lrp6	UTSW	6	134484250	missense	probably damaging	1.00
R4661:Lrp6	UTSW	6	134511267	missense	probably benign
R4688:Lrp6	UTSW	6	134479743	missense	probably damaging	1.00
R4784:Lrp6	UTSW	6	134479539	missense	probably benign	0.06
R5236:Lrp6	UTSW	6	134511264	missense	probably damaging	1.00
R5506:Lrp6	UTSW	6	134459296	missense	probably benign	0.09
R5508:Lrp6	UTSW	6	134464516	missense	probably benign	0.31
R6001:Lrp6	UTSW	6	134464518	missense	probably benign	0.03
R6319:Lrp6	UTSW	6	134541835	missense	possibly damaging	0.46
R6537:Lrp6	UTSW	6	134480495	missense	probably benign
R6552:Lrp6	UTSW	6	134454729	missense	probably benign	0.17
R6559:Lrp6	UTSW	6	134513254	missense	probably damaging	1.00
R6575:Lrp6	UTSW	6	134541971	missense	possibly damaging	0.80
R6700:Lrp6	UTSW	6	134479560	missense	probably damaging	1.00
R6724:Lrp6	UTSW	6	134486541	missense	possibly damaging	0.94
R7159:Lrp6	UTSW	6	134507551	missense	probably benign
R7266:Lrp6	UTSW	6	134507401	missense	probably damaging	1.00
R7339:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7341:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7342:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7348:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7359:Lrp6	UTSW	6	134450960	nonsense	probably null
R7366:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7368:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7501:Lrp6	UTSW	6	134486508	missense	probably damaging	1.00
R7548:Lrp6	UTSW	6	134507508	missense	probably damaging	0.97
R7652:Lrp6	UTSW	6	134511245	nonsense	probably null
R7771:Lrp6	UTSW	6	134462616	missense	probably damaging	1.00
R7927:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
R8717:Lrp6	UTSW	6	134457748	missense	probably benign	0.41
R8726:Lrp6	UTSW	6	134507661	nonsense	probably null
R8792:Lrp6	UTSW	6	134486586	missense	probably damaging	0.99
R8812:Lrp6	UTSW	6	134456178	missense	probably benign
R8855:Lrp6	UTSW	6	134468822	missense	probably benign	0.04
R8866:Lrp6	UTSW	6	134468822	missense	probably benign	0.04
R8994:Lrp6	UTSW	6	134541693	missense	probably benign
R9021:Lrp6	UTSW	6	134541967	missense	probably benign	0.00
R9089:Lrp6	UTSW	6	134511206	missense	probably damaging	0.97
R9154:Lrp6	UTSW	6	134541892	missense	probably damaging	1.00
R9263:Lrp6	UTSW	6	134480504	missense	probably damaging	1.00
R9287:Lrp6	UTSW	6	134506296	missense	probably benign	0.21
Z1176:Lrp6	UTSW	6	134456157	missense	possibly damaging	0.72
Z1177:Lrp6	UTSW	6	134462541	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTCATGGTCCCATTGAGC -3'
(R):5'- TAGAGAGTGACTAAATTTTGCCTGTGG -3'

Sequencing Primer
(F):5'- CTATACGATCCGTGCCAGTG -3'
(R):5'- CCTGTGGCTTTCCAATGTTTG -3'

Posted On

2018-06-22