Incidental Mutation 'R6585:Lrp6'
ID524336
Institutional Source Beutler Lab
Gene Symbol Lrp6
Ensembl Gene ENSMUSG00000030201
Gene Namelow density lipoprotein receptor-related protein 6
Synonymsskax26, Cd, ska26, ska
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location134446476-134566965 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 134507558 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 367 (Y367*)
Ref Sequence ENSEMBL: ENSMUSP00000032322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032322] [ENSMUST00000126836]
Predicted Effect probably null
Transcript: ENSMUST00000032322
AA Change: Y367*
SMART Domains Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: Y367*

DomainStartEndE-ValueType
LY 43 85 1.55e-2 SMART
LY 87 129 1.91e-11 SMART
LY 130 173 5.19e-13 SMART
LY 174 216 1.39e-13 SMART
LY 217 258 2.87e-6 SMART
EGF 285 324 2.16e-1 SMART
low complexity region 330 341 N/A INTRINSIC
LY 352 394 1.29e-8 SMART
LY 395 437 5.73e-15 SMART
LY 438 481 1.07e-14 SMART
LY 482 524 3.07e-15 SMART
LY 525 565 4.66e-6 SMART
EGF 591 628 1.47e-3 SMART
LY 654 696 2.06e-7 SMART
LY 697 739 3.73e-14 SMART
LY 740 783 3.37e-12 SMART
LY 784 825 1.17e-6 SMART
LY 827 865 1.91e-2 SMART
EGF 892 930 7.35e-4 SMART
LY 957 999 1.41e-5 SMART
LY 1005 1048 5.32e-1 SMART
LY 1049 1093 5e-6 SMART
LY 1094 1136 4.25e-9 SMART
LY 1137 1177 1.91e-2 SMART
EGF 1206 1250 1.23e1 SMART
LDLa 1248 1287 2.42e-12 SMART
LDLa 1288 1324 4.37e-10 SMART
LDLa 1325 1362 1.66e-10 SMART
transmembrane domain 1371 1393 N/A INTRINSIC
low complexity region 1429 1438 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1566 1573 N/A INTRINSIC
low complexity region 1596 1608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126836
SMART Domains Protein: ENSMUSP00000144733
Gene: ENSMUSG00000030201

DomainStartEndE-ValueType
LY 23 65 6.8e-16 SMART
LY 66 107 1.4e-8 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Lrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrp6 APN 6 134456090 missense probably benign 0.17
IGL00765:Lrp6 APN 6 134541854 missense probably benign 0.02
IGL00898:Lrp6 APN 6 134479739 missense probably damaging 0.99
IGL00916:Lrp6 APN 6 134484289 missense probably damaging 1.00
IGL00961:Lrp6 APN 6 134507646 missense probably damaging 0.98
IGL01620:Lrp6 APN 6 134511262 missense probably damaging 1.00
IGL01765:Lrp6 APN 6 134456145 missense probably damaging 0.99
IGL02066:Lrp6 APN 6 134450937 nonsense probably null
IGL02067:Lrp6 APN 6 134480396 missense probably damaging 0.99
IGL02169:Lrp6 APN 6 134513327 missense probably damaging 0.96
IGL02281:Lrp6 APN 6 134457734 missense probably benign 0.40
IGL02484:Lrp6 APN 6 134541923 missense probably benign 0.15
IGL02724:Lrp6 APN 6 134484265 missense probably damaging 1.00
IGL02876:Lrp6 APN 6 134456114 missense probably benign 0.43
IGL03011:Lrp6 APN 6 134520417 missense possibly damaging 0.80
IGL03352:Lrp6 APN 6 134479763 missense probably damaging 1.00
Coiled UTSW 6 134507558 nonsense probably null
BB004:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
BB014:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
PIT4494001:Lrp6 UTSW 6 134479778 missense probably damaging 1.00
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0201:Lrp6 UTSW 6 134450897 nonsense probably null
R0295:Lrp6 UTSW 6 134457693 missense probably benign 0.02
R0370:Lrp6 UTSW 6 134479766 missense probably damaging 1.00
R0382:Lrp6 UTSW 6 134467668 missense probably damaging 1.00
R0413:Lrp6 UTSW 6 134507624 missense probably damaging 0.99
R0468:Lrp6 UTSW 6 134485661 missense possibly damaging 0.94
R0492:Lrp6 UTSW 6 134480518 missense possibly damaging 0.58
R0584:Lrp6 UTSW 6 134456076 missense probably damaging 0.99
R0631:Lrp6 UTSW 6 134479775 missense possibly damaging 0.95
R0738:Lrp6 UTSW 6 134542045 missense probably benign 0.13
R0907:Lrp6 UTSW 6 134507525 missense probably damaging 0.96
R1273:Lrp6 UTSW 6 134467507 critical splice donor site probably null
R1548:Lrp6 UTSW 6 134459429 missense possibly damaging 0.89
R1639:Lrp6 UTSW 6 134453566 missense possibly damaging 0.68
R1650:Lrp6 UTSW 6 134468769 missense probably benign 0.01
R1696:Lrp6 UTSW 6 134468723 missense probably damaging 1.00
R1751:Lrp6 UTSW 6 134464568 missense probably damaging 1.00
R1780:Lrp6 UTSW 6 134464451 missense probably damaging 0.99
R2013:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2015:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2165:Lrp6 UTSW 6 134459283 missense probably damaging 1.00
R2294:Lrp6 UTSW 6 134457742 missense probably damaging 1.00
R2336:Lrp6 UTSW 6 134507583 missense probably damaging 0.97
R2964:Lrp6 UTSW 6 134467526 missense probably damaging 1.00
R3716:Lrp6 UTSW 6 134507447 missense probably damaging 1.00
R4017:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
R4370:Lrp6 UTSW 6 134506358 nonsense probably null
R4521:Lrp6 UTSW 6 134485862 missense probably damaging 1.00
R4573:Lrp6 UTSW 6 134470730 nonsense probably null
R4645:Lrp6 UTSW 6 134484250 missense probably damaging 1.00
R4661:Lrp6 UTSW 6 134511267 missense probably benign
R4688:Lrp6 UTSW 6 134479743 missense probably damaging 1.00
R4784:Lrp6 UTSW 6 134479539 missense probably benign 0.06
R5236:Lrp6 UTSW 6 134511264 missense probably damaging 1.00
R5506:Lrp6 UTSW 6 134459296 missense probably benign 0.09
R5508:Lrp6 UTSW 6 134464516 missense probably benign 0.31
R6001:Lrp6 UTSW 6 134464518 missense probably benign 0.03
R6319:Lrp6 UTSW 6 134541835 missense possibly damaging 0.46
R6537:Lrp6 UTSW 6 134480495 missense probably benign
R6552:Lrp6 UTSW 6 134454729 missense probably benign 0.17
R6559:Lrp6 UTSW 6 134513254 missense probably damaging 1.00
R6575:Lrp6 UTSW 6 134541971 missense possibly damaging 0.80
R6700:Lrp6 UTSW 6 134479560 missense probably damaging 1.00
R6724:Lrp6 UTSW 6 134486541 missense possibly damaging 0.94
R7159:Lrp6 UTSW 6 134507551 missense probably benign
R7266:Lrp6 UTSW 6 134507401 missense probably damaging 1.00
R7339:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7341:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7342:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7348:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7359:Lrp6 UTSW 6 134450960 nonsense probably null
R7366:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7368:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7501:Lrp6 UTSW 6 134486508 missense probably damaging 1.00
R7548:Lrp6 UTSW 6 134507508 missense probably damaging 0.97
R7652:Lrp6 UTSW 6 134511245 nonsense probably null
R7771:Lrp6 UTSW 6 134462616 missense probably damaging 1.00
R7927:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
Z1176:Lrp6 UTSW 6 134456157 missense possibly damaging 0.72
Z1177:Lrp6 UTSW 6 134462541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCATGGTCCCATTGAGC -3'
(R):5'- TAGAGAGTGACTAAATTTTGCCTGTGG -3'

Sequencing Primer
(F):5'- CTATACGATCCGTGCCAGTG -3'
(R):5'- CCTGTGGCTTTCCAATGTTTG -3'
Posted On2018-06-22