Incidental Mutation 'R6648:Gm21994'
ID524337
Institutional Source Beutler Lab
Gene Symbol Gm21994
Ensembl Gene ENSMUSG00000074735
Gene Namepredicted gene 21994
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R6648 (G1)
Quality Score149.008
Status Validated
Chromosome2
Chromosomal Location150254518-150255591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150255177 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 111 (I111V)
Ref Sequence ENSEMBL: ENSMUSP00000075719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063463] [ENSMUST00000109922]
Predicted Effect probably benign
Transcript: ENSMUST00000063463
AA Change: I111V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000075719
Gene: ENSMUSG00000074735
AA Change: I111V

DomainStartEndE-ValueType
ZnF_C2H2 1 18 2.7e2 SMART
ZnF_C2H2 53 73 2.75e1 SMART
ZnF_C2H2 77 99 6.42e-4 SMART
ZnF_C2H2 132 154 1.58e-3 SMART
ZnF_C2H2 160 182 1.12e-3 SMART
ZnF_C2H2 188 210 4.01e-5 SMART
ZnF_C2H2 216 238 3.16e-3 SMART
ZnF_C2H2 244 266 8.94e-3 SMART
ZnF_C2H2 272 294 9.58e-3 SMART
ZnF_C2H2 300 322 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109922
SMART Domains Protein: ENSMUSP00000105548
Gene: ENSMUSG00000079008

DomainStartEndE-ValueType
KRAB 4 66 9.26e-19 SMART
ZnF_C2H2 103 125 7.49e-5 SMART
ZnF_C2H2 131 151 9.46e0 SMART
ZnF_C2H2 159 181 5.9e-3 SMART
ZnF_C2H2 187 209 6.67e-2 SMART
ZnF_C2H2 215 237 4.87e-4 SMART
ZnF_C2H2 243 265 2.82e0 SMART
ZnF_C2H2 271 293 2.2e2 SMART
ZnF_C2H2 299 321 1.4e-4 SMART
ZnF_C2H2 327 349 1.6e-4 SMART
ZnF_C2H2 355 377 1.18e-2 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
ZnF_C2H2 411 433 9.56e1 SMART
ZnF_C2H2 439 461 6.99e-5 SMART
ZnF_C2H2 467 489 2.99e-4 SMART
ZnF_C2H2 495 517 7.78e-3 SMART
ZnF_C2H2 523 545 1.04e-3 SMART
ZnF_C2H2 551 573 1.6e-4 SMART
ZnF_C2H2 579 601 1.18e-2 SMART
ZnF_C2H2 607 629 4.54e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 1.2e-3 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Gm21994
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6648_Gm21994_337 UTSW 2 150255177 missense probably benign 0.01
R0853:Gm21994 UTSW 2 150255478 missense probably benign 0.30
R5135:Gm21994 UTSW 2 150255490 nonsense probably null
R5161:Gm21994 UTSW 2 150255215 missense probably damaging 0.99
R5782:Gm21994 UTSW 2 150255518 missense probably benign 0.41
R6019:Gm21994 UTSW 2 150255212 missense probably damaging 1.00
R6284:Gm21994 UTSW 2 150255278 missense possibly damaging 0.95
R6476:Gm21994 UTSW 2 150255326 missense probably benign 0.00
R6479:Gm21994 UTSW 2 150254591 missense probably damaging 0.99
R6736:Gm21994 UTSW 2 150255278 missense possibly damaging 0.95
R6963:Gm21994 UTSW 2 150255345 missense probably damaging 1.00
R7014:Gm21994 UTSW 2 150255262 nonsense probably null
R7138:Gm21994 UTSW 2 150255452 missense probably damaging 1.00
R7625:Gm21994 UTSW 2 150254600 missense probably benign 0.05
R7855:Gm21994 UTSW 2 150255146 missense probably benign 0.00
R8145:Gm21994 UTSW 2 150254535 missense probably benign 0.00
R8284:Gm21994 UTSW 2 150255356 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GAGATGACTATTTCCTGCAAAGGC -3'
(R):5'- GAAACCCTATGGAGGTGTCCAAC -3'

Sequencing Primer
(F):5'- GGCTTTACCACACTGGTTAC -3'
(R):5'- AAACAACACTTGCTGGAGTG -3'
Posted On2018-06-22