Incidental Mutation 'R6585:Olfr290'
List |< first << previous [record 21 of 31] next >> last >|
ID524342
Institutional Source Beutler Lab
Gene Symbol Olfr290
Ensembl Gene ENSMUSG00000116179
Gene Name
SynonymsGA_x6K02T2NHDJ-11170115-11169168, MOR254-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location84915781-84916728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84916462 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 228 (I228F)
Ref Sequence ENSEMBL: ENSMUSP00000149523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073468] [ENSMUST00000214501] [ENSMUST00000216184] [ENSMUST00000216367]
Predicted Effect probably damaging
Transcript: ENSMUST00000073468
AA Change: I228F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073172
Gene: ENSMUSG00000116179
AA Change: I228F

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 8.4e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.2e-10 PFAM
Pfam:7tm_1 41 291 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173463
Predicted Effect probably damaging
Transcript: ENSMUST00000214501
AA Change: I228F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216184
AA Change: I228F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216367
AA Change: I228F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Olfr290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr290 APN 7 84916370 missense probably damaging 0.99
IGL01322:Olfr290 APN 7 84916382 missense probably damaging 0.99
IGL01834:Olfr290 APN 7 84916652 missense probably damaging 1.00
IGL02556:Olfr290 APN 7 84916359 nonsense probably null
IGL03246:Olfr290 APN 7 84916711 missense probably benign 0.03
IGL03255:Olfr290 APN 7 84916517 missense possibly damaging 0.95
R0322:Olfr290 UTSW 7 84916313 missense probably damaging 1.00
R1253:Olfr290 UTSW 7 84916709 missense probably benign
R1652:Olfr290 UTSW 7 84916520 missense probably damaging 1.00
R1673:Olfr290 UTSW 7 84916117 missense probably damaging 0.97
R1891:Olfr290 UTSW 7 84916253 missense possibly damaging 0.93
R1895:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R1946:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R2128:Olfr290 UTSW 7 84916493 missense probably damaging 1.00
R4435:Olfr290 UTSW 7 84916021 missense probably benign 0.45
R4822:Olfr290 UTSW 7 84916426 missense possibly damaging 0.81
R4834:Olfr290 UTSW 7 84916283 missense probably damaging 1.00
R5354:Olfr290 UTSW 7 84916149 nonsense probably null
R5644:Olfr290 UTSW 7 84916119 missense probably benign 0.15
R5650:Olfr290 UTSW 7 84916418 missense possibly damaging 0.50
R5708:Olfr290 UTSW 7 84916183 missense possibly damaging 0.56
R7774:Olfr290 UTSW 7 84916531 missense probably damaging 0.97
R8126:Olfr290 UTSW 7 84915906 missense probably damaging 1.00
R8443:Olfr290 UTSW 7 84916579 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCTGGGTTTCTGAACTCC -3'
(R):5'- CATGGGAGTAATGACCCCATAC -3'

Sequencing Primer
(F):5'- GAACTCCTTTGTCCACACAATG -3'
(R):5'- CCATACAACATAGAGATGAGTCTGTC -3'
Posted On2018-06-22