Incidental Mutation 'R6648:Osbpl9'
ID524345
Institutional Source Beutler Lab
Gene Symbol Osbpl9
Ensembl Gene ENSMUSG00000028559
Gene Nameoxysterol binding protein-like 9
SynonymsORP-9, 2600011I06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6648 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location109061145-109202272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109091679 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 91 (Q91H)
Ref Sequence ENSEMBL: ENSMUSP00000081396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030288] [ENSMUST00000084366] [ENSMUST00000159545] [ENSMUST00000160271] [ENSMUST00000160774] [ENSMUST00000161363] [ENSMUST00000162787] [ENSMUST00000194478]
Predicted Effect probably benign
Transcript: ENSMUST00000030288
AA Change: Q188H

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030288
Gene: ENSMUSG00000028559
AA Change: Q188H

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 253 274 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 349 362 N/A INTRINSIC
Pfam:Oxysterol_BP 377 729 7.3e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000084366
AA Change: Q91H

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081396
Gene: ENSMUSG00000028559
AA Change: Q91H

DomainStartEndE-ValueType
low complexity region 156 177 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 252 265 N/A INTRINSIC
Pfam:Oxysterol_BP 277 634 7.2e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159198
Predicted Effect probably benign
Transcript: ENSMUST00000159545
SMART Domains Protein: ENSMUSP00000123856
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
Blast:PH 3 54 6e-33 BLAST
SCOP:d1pls__ 4 46 9e-8 SMART
PDB:2KCJ|A 4 55 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160271
SMART Domains Protein: ENSMUSP00000124112
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
low complexity region 143 164 N/A INTRINSIC
low complexity region 175 191 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
Pfam:Oxysterol_BP 264 621 4.7e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160774
AA Change: Q171H

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124742
Gene: ENSMUSG00000028559
AA Change: Q171H

DomainStartEndE-ValueType
PH 3 84 6.46e-8 SMART
low complexity region 236 257 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
Pfam:Oxysterol_BP 357 714 2.8e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160895
Predicted Effect probably benign
Transcript: ENSMUST00000161363
SMART Domains Protein: ENSMUSP00000125714
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
Blast:PH 13 34 3e-6 BLAST
low complexity region 173 194 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Pfam:Oxysterol_BP 294 651 2.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162787
SMART Domains Protein: ENSMUSP00000124370
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 272 288 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Pfam:Oxysterol_BP 361 718 2.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194478
SMART Domains Protein: ENSMUSP00000141991
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
PH 3 101 3.7e-19 SMART
low complexity region 263 284 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Oxysterol_BP 384 741 2e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161602
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. This family member functions as a cholesterol transfer protein that regulates Golgi structure and function. Multiple transcript variants, most of which encode distinct isoforms, have been identified. Related pseudogenes have been identified on chromosomes 3, 11 and 12. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Osbpl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Osbpl9 APN 4 109072010 missense probably damaging 1.00
IGL00793:Osbpl9 APN 4 109087431 missense probably damaging 0.99
IGL00809:Osbpl9 APN 4 109133763 missense probably damaging 1.00
IGL02071:Osbpl9 APN 4 109071979 missense probably damaging 1.00
IGL02547:Osbpl9 APN 4 109068483 nonsense probably null
IGL02822:Osbpl9 APN 4 109072921 missense probably damaging 1.00
IGL03074:Osbpl9 APN 4 109071961 missense probably damaging 1.00
IGL03193:Osbpl9 APN 4 109066966 missense possibly damaging 0.90
IGL03196:Osbpl9 APN 4 109072864 missense probably damaging 1.00
IGL03306:Osbpl9 APN 4 109172332 splice site probably benign
IGL03323:Osbpl9 APN 4 109062459 splice site probably benign
Oblong UTSW 4 109091679 missense possibly damaging 0.62
R0211:Osbpl9 UTSW 4 109073124 missense probably damaging 1.00
R0368:Osbpl9 UTSW 4 109066932 missense probably damaging 1.00
R0620:Osbpl9 UTSW 4 109083128 missense probably damaging 1.00
R1439:Osbpl9 UTSW 4 109101156 missense probably damaging 1.00
R1711:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R1757:Osbpl9 UTSW 4 109064583 missense probably damaging 1.00
R2237:Osbpl9 UTSW 4 109156657 missense probably damaging 1.00
R2295:Osbpl9 UTSW 4 109202134 missense probably damaging 0.99
R2418:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R3111:Osbpl9 UTSW 4 109083093 missense probably benign 0.08
R4202:Osbpl9 UTSW 4 109172240 intron probably benign
R4672:Osbpl9 UTSW 4 109064609 missense possibly damaging 0.82
R4706:Osbpl9 UTSW 4 109156687 missense probably damaging 1.00
R4856:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R4886:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R5035:Osbpl9 UTSW 4 109066167 missense probably damaging 0.99
R5309:Osbpl9 UTSW 4 109066155 missense probably damaging 1.00
R5400:Osbpl9 UTSW 4 109062300 nonsense probably null
R5719:Osbpl9 UTSW 4 109062566 nonsense probably null
R5810:Osbpl9 UTSW 4 109086374 missense probably benign 0.00
R6237:Osbpl9 UTSW 4 109156702 missense probably damaging 1.00
R6575:Osbpl9 UTSW 4 109072932 missense possibly damaging 0.89
R6675:Osbpl9 UTSW 4 109133828 splice site probably null
R7130:Osbpl9 UTSW 4 109083099 missense probably benign
R7356:Osbpl9 UTSW 4 109068480 nonsense probably null
R7615:Osbpl9 UTSW 4 109086339 missense probably damaging 1.00
R7753:Osbpl9 UTSW 4 109133773 missense possibly damaging 0.86
R7772:Osbpl9 UTSW 4 109066187 missense probably damaging 0.99
R7788:Osbpl9 UTSW 4 109062494 missense probably benign 0.41
R8083:Osbpl9 UTSW 4 109086375 missense possibly damaging 0.74
R8143:Osbpl9 UTSW 4 109065709 missense probably benign 0.12
R8323:Osbpl9 UTSW 4 109107922 missense probably benign 0.01
R8331:Osbpl9 UTSW 4 109066181 missense probably damaging 1.00
R8406:Osbpl9 UTSW 4 109064573 missense possibly damaging 0.82
R8531:Osbpl9 UTSW 4 109156711 missense probably damaging 1.00
R8715:Osbpl9 UTSW 4 109102576 missense probably benign 0.21
Z1177:Osbpl9 UTSW 4 109107880 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATGGCCAACGTTAGGAGC -3'
(R):5'- GTTGTCTCACCATGGTAGAATTG -3'

Sequencing Primer
(F):5'- TGGCCAACGTTAGGAGCTCAAG -3'
(R):5'- CTCACCATGGTAGAATTGTGTCTG -3'
Posted On2018-06-22