Incidental Mutation 'R6585:Urb2'
List |< first << previous [record 29 of 31] next >> last >|
ID524346
Institutional Source Beutler Lab
Gene Symbol Urb2
Ensembl Gene ENSMUSG00000031976
Gene NameURB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124021508-124048505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 124031125 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1190 (E1190D)
Ref Sequence ENSEMBL: ENSMUSP00000133547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034457] [ENSMUST00000127664] [ENSMUST00000173168]
Predicted Effect probably damaging
Transcript: ENSMUST00000034457
AA Change: E1190D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034457
Gene: ENSMUSG00000031976
AA Change: E1190D

DomainStartEndE-ValueType
low complexity region 489 503 N/A INTRINSIC
low complexity region 541 546 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
low complexity region 1073 1092 N/A INTRINSIC
low complexity region 1172 1188 N/A INTRINSIC
low complexity region 1273 1279 N/A INTRINSIC
Pfam:Urb2 1319 1515 2.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173168
AA Change: E1190D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133547
Gene: ENSMUSG00000031976
AA Change: E1190D

DomainStartEndE-ValueType
low complexity region 489 503 N/A INTRINSIC
low complexity region 541 546 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
low complexity region 1073 1092 N/A INTRINSIC
low complexity region 1172 1188 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212460
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Urb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Urb2 APN 8 124028694 missense probably damaging 1.00
IGL00705:Urb2 APN 8 124036637 missense probably benign 0.00
IGL02090:Urb2 APN 8 124028237 missense probably benign 0.28
IGL02707:Urb2 APN 8 124030686 missense probably benign 0.04
IGL03103:Urb2 APN 8 124029752 missense probably benign 0.17
IGL03402:Urb2 APN 8 124029849 missense possibly damaging 0.92
R0037:Urb2 UTSW 8 124047195 missense probably damaging 1.00
R0113:Urb2 UTSW 8 124030926 missense probably benign 0.00
R0883:Urb2 UTSW 8 124030970 nonsense probably null
R1015:Urb2 UTSW 8 124029434 missense probably damaging 1.00
R1265:Urb2 UTSW 8 124025153 missense probably damaging 1.00
R1463:Urb2 UTSW 8 124030908 missense probably benign 0.04
R1497:Urb2 UTSW 8 124028077 missense probably damaging 1.00
R1556:Urb2 UTSW 8 124030617 missense probably damaging 1.00
R1622:Urb2 UTSW 8 124029624 missense probably benign
R1914:Urb2 UTSW 8 124029798 missense possibly damaging 0.81
R1915:Urb2 UTSW 8 124029798 missense possibly damaging 0.81
R2172:Urb2 UTSW 8 124031102 missense probably damaging 1.00
R2240:Urb2 UTSW 8 124030139 missense probably benign 0.02
R2424:Urb2 UTSW 8 124030426 missense probably benign 0.02
R4085:Urb2 UTSW 8 124030941 missense probably benign 0.02
R4119:Urb2 UTSW 8 124047240 missense probably benign 0.00
R4732:Urb2 UTSW 8 124028897 missense probably damaging 1.00
R4733:Urb2 UTSW 8 124028897 missense probably damaging 1.00
R4865:Urb2 UTSW 8 124029635 nonsense probably null
R5005:Urb2 UTSW 8 124031181 missense probably damaging 0.97
R5381:Urb2 UTSW 8 124029912 missense probably benign 0.02
R5704:Urb2 UTSW 8 124038182 missense probably damaging 0.97
R5891:Urb2 UTSW 8 124030856 missense possibly damaging 0.64
R5958:Urb2 UTSW 8 124029659 missense probably benign 0.01
R5966:Urb2 UTSW 8 124028088 missense probably benign 0.00
R6133:Urb2 UTSW 8 124028561 nonsense probably null
R6136:Urb2 UTSW 8 124030092 missense probably benign
R6341:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6343:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6344:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6417:Urb2 UTSW 8 124047199 missense probably damaging 1.00
R6420:Urb2 UTSW 8 124047199 missense probably damaging 1.00
R6586:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6587:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6588:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R7061:Urb2 UTSW 8 124028297 missense probably benign
R7090:Urb2 UTSW 8 124030599 missense probably benign
R7371:Urb2 UTSW 8 124028269 missense probably benign 0.00
R7467:Urb2 UTSW 8 124028511 missense probably benign
R7542:Urb2 UTSW 8 124028588 missense probably benign
R7545:Urb2 UTSW 8 124029752 missense probably benign 0.00
R7686:Urb2 UTSW 8 124045172 missense probably benign 0.01
R8046:Urb2 UTSW 8 124028032 missense possibly damaging 0.92
R8101:Urb2 UTSW 8 124028040 missense probably benign 0.01
R8404:Urb2 UTSW 8 124025203 missense probably damaging 1.00
X0020:Urb2 UTSW 8 124030983 missense possibly damaging 0.91
X0027:Urb2 UTSW 8 124028814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCAAAATTGCTCAAGTGG -3'
(R):5'- TGCAGCACAGAATCAGCTCAG -3'

Sequencing Primer
(F):5'- CCCAAAATTGCTCAAGTGGTGGATAC -3'
(R):5'- CATCAGTTACTTCAGTGCCAGGAG -3'
Posted On2018-06-22