Incidental Mutation 'R6585:Kcnj1'
List |< first << previous [record 15 of 31] next >> last >|
ID524348
Institutional Source Beutler Lab
Gene Symbol Kcnj1
Ensembl Gene ENSMUSG00000041248
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 1
SynonymsKir1.1, ROMK, ROMK-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location32372493-32399197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32397261 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 307 (V307A)
Ref Sequence ENSEMBL: ENSMUSP00000150540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047334] [ENSMUST00000172015] [ENSMUST00000213393]
Predicted Effect probably benign
Transcript: ENSMUST00000047334
AA Change: V307A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046793
Gene: ENSMUSG00000041248
AA Change: V307A

DomainStartEndE-ValueType
Pfam:IRK 24 361 1.4e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172015
AA Change: V327A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131625
Gene: ENSMUSG00000041248
AA Change: V327A

DomainStartEndE-ValueType
Pfam:IRK 44 373 7.6e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213393
AA Change: V307A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null mutation die before weaning with impaired electrolyte, acid-base, and fluid-volume homeostasis, reduced NaCl absorption in the thick ascending limb, and abnormal tubuloglomerular feedback. A colony of mutants with extended suvival serves as a model for Bartter's syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Kcnj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Kcnj1 APN 9 32396498 missense probably benign 0.01
IGL02958:Kcnj1 APN 9 32396555 missense probably damaging 1.00
IGL03285:Kcnj1 APN 9 32396861 missense possibly damaging 0.67
R1179:Kcnj1 UTSW 9 32396766 missense probably damaging 0.96
R1503:Kcnj1 UTSW 9 32396492 missense probably damaging 0.98
R1918:Kcnj1 UTSW 9 32396738 missense probably benign 0.00
R4439:Kcnj1 UTSW 9 32394118 intron probably benign
R4659:Kcnj1 UTSW 9 32394148 missense probably benign
R4661:Kcnj1 UTSW 9 32396622 missense probably benign 0.14
R4917:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R4918:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R5385:Kcnj1 UTSW 9 32396723 missense probably damaging 1.00
R6017:Kcnj1 UTSW 9 32394104 intron probably benign
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6117:Kcnj1 UTSW 9 32397182 missense probably damaging 1.00
R6245:Kcnj1 UTSW 9 32396867 missense probably damaging 1.00
R6316:Kcnj1 UTSW 9 32397336 missense probably damaging 0.96
R6988:Kcnj1 UTSW 9 32396585 missense probably benign 0.17
R7116:Kcnj1 UTSW 9 32396981 missense possibly damaging 0.91
R7393:Kcnj1 UTSW 9 32397018 missense probably damaging 1.00
R7870:Kcnj1 UTSW 9 32396585 missense probably benign 0.17
R8072:Kcnj1 UTSW 9 32397297 missense probably damaging 1.00
R8391:Kcnj1 UTSW 9 32396732 missense probably damaging 1.00
Z1177:Kcnj1 UTSW 9 32397359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTTTGTAGTTGATGCTGGC -3'
(R):5'- GCCACTGCTACATTTGGGTG -3'

Sequencing Primer
(F):5'- GTTGATGCTGGCAATGAAAATTTG -3'
(R):5'- GTCTGTTTCATCAACTTCTGACAAG -3'
Posted On2018-06-22