Incidental Mutation 'R6648:Slc41a3'
ID524352
Institutional Source Beutler Lab
Gene Symbol Slc41a3
Ensembl Gene ENSMUSG00000030089
Gene Namesolute carrier family 41, member 3
Synonyms1010001P06Rik, SLC41A1-L2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6648 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location90604725-90646412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90619508 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 20 (F20L)
Ref Sequence ENSEMBL: ENSMUSP00000032177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032177] [ENSMUST00000044019]
Predicted Effect probably damaging
Transcript: ENSMUST00000032177
AA Change: F20L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032177
Gene: ENSMUSG00000030089
AA Change: F20L

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
Pfam:MgtE 80 214 3.4e-27 PFAM
transmembrane domain 224 246 N/A INTRINSIC
transmembrane domain 258 277 N/A INTRINSIC
Pfam:MgtE 293 437 9.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044019
SMART Domains Protein: ENSMUSP00000037473
Gene: ENSMUSG00000030089

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:MgtE 106 240 2.5e-27 PFAM
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 284 303 N/A INTRINSIC
Pfam:MgtE 319 463 7.2e-27 PFAM
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered magnesium ion homeostasis including hypomagnesemia. A subset of homozygotes develop severe unilateral hydronephrosis when fed a low magnesium diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Slc41a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Slc41a3 APN 6 90645714 missense probably damaging 1.00
IGL02583:Slc41a3 APN 6 90644171 missense probably damaging 0.99
PIT4378001:Slc41a3 UTSW 6 90640909 missense probably benign 0.36
R1076:Slc41a3 UTSW 6 90644160 missense probably benign
R1529:Slc41a3 UTSW 6 90644216 missense probably damaging 0.99
R1591:Slc41a3 UTSW 6 90633695 missense probably benign 0.02
R1985:Slc41a3 UTSW 6 90642228 missense probably damaging 1.00
R2133:Slc41a3 UTSW 6 90626381 missense probably damaging 0.99
R2308:Slc41a3 UTSW 6 90612120 missense possibly damaging 0.51
R2384:Slc41a3 UTSW 6 90626411 missense probably damaging 0.98
R2697:Slc41a3 UTSW 6 90642320 missense possibly damaging 0.81
R3237:Slc41a3 UTSW 6 90636865 missense probably benign 0.10
R4287:Slc41a3 UTSW 6 90640922 missense probably benign 0.00
R4394:Slc41a3 UTSW 6 90635330 missense probably damaging 1.00
R5039:Slc41a3 UTSW 6 90626417 missense probably damaging 1.00
R5195:Slc41a3 UTSW 6 90633671 missense probably damaging 1.00
R5293:Slc41a3 UTSW 6 90626444 missense probably damaging 0.99
R5338:Slc41a3 UTSW 6 90612171 missense possibly damaging 0.93
R5608:Slc41a3 UTSW 6 90640907 missense probably benign 0.06
R5681:Slc41a3 UTSW 6 90640946 missense probably damaging 0.99
R5783:Slc41a3 UTSW 6 90619542 missense probably benign 0.06
R7867:Slc41a3 UTSW 6 90640927 missense probably damaging 0.96
R8733:Slc41a3 UTSW 6 90633728 missense possibly damaging 0.95
R8776:Slc41a3 UTSW 6 90644183 missense probably benign 0.06
R8776-TAIL:Slc41a3 UTSW 6 90644183 missense probably benign 0.06
R8905:Slc41a3 UTSW 6 90612141 missense probably benign 0.11
X0025:Slc41a3 UTSW 6 90635322 missense probably damaging 1.00
Z1177:Slc41a3 UTSW 6 90619573 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCTCAGAGACCCACTGTG -3'
(R):5'- TATCTTCTCACCAGCACGAC -3'

Sequencing Primer
(F):5'- ACTGTGGCACTTCCTGGAAAG -3'
(R):5'- ACGACTGGTGCTGGATCC -3'
Posted On2018-06-22