Incidental Mutation 'R6648:Tmc3'
ID524354
Institutional Source Beutler Lab
Gene Symbol Tmc3
Ensembl Gene ENSMUSG00000038540
Gene Nametransmembrane channel-like gene family 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6648 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location83584927-83625614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83597543 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 164 (V164D)
Ref Sequence ENSEMBL: ENSMUSP00000130348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039317] [ENSMUST00000164944]
Predicted Effect probably damaging
Transcript: ENSMUST00000039317
AA Change: V164D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046028
Gene: ENSMUSG00000038540
AA Change: V164D

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 5e-42 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1071 1089 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163297
Predicted Effect probably damaging
Transcript: ENSMUST00000164944
AA Change: V164D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130348
Gene: ENSMUSG00000038540
AA Change: V164D

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 1.1e-45 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1042 1060 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171397
Meta Mutation Damage Score 0.2005 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Tmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Tmc3 APN 7 83603474 missense probably null 1.00
IGL01372:Tmc3 APN 7 83612538 missense probably damaging 1.00
IGL02072:Tmc3 APN 7 83615940 missense probably benign 0.00
IGL02168:Tmc3 APN 7 83619995 missense possibly damaging 0.87
IGL02344:Tmc3 APN 7 83609094 missense probably benign 0.00
IGL02421:Tmc3 APN 7 83622744 missense probably benign
IGL02604:Tmc3 APN 7 83622619 missense possibly damaging 0.85
IGL02863:Tmc3 APN 7 83622286 missense probably benign 0.04
IGL02863:Tmc3 APN 7 83622285 missense possibly damaging 0.61
IGL03058:Tmc3 APN 7 83615886 missense possibly damaging 0.91
IGL03303:Tmc3 APN 7 83590725 splice site probably benign
F5770:Tmc3 UTSW 7 83622505 missense probably benign 0.01
R0133:Tmc3 UTSW 7 83612473 missense probably damaging 1.00
R0147:Tmc3 UTSW 7 83607742 missense probably damaging 1.00
R0304:Tmc3 UTSW 7 83596139 missense probably damaging 1.00
R0320:Tmc3 UTSW 7 83607819 splice site probably benign
R0478:Tmc3 UTSW 7 83622152 missense possibly damaging 0.66
R0714:Tmc3 UTSW 7 83616761 missense possibly damaging 0.94
R1471:Tmc3 UTSW 7 83598290 missense probably damaging 1.00
R1725:Tmc3 UTSW 7 83604732 missense probably damaging 1.00
R1775:Tmc3 UTSW 7 83612532 missense probably benign 0.39
R2176:Tmc3 UTSW 7 83609308 missense probably damaging 1.00
R4001:Tmc3 UTSW 7 83620063 missense probably benign 0.01
R4229:Tmc3 UTSW 7 83597402 intron probably benign
R4635:Tmc3 UTSW 7 83585082 unclassified probably benign
R4715:Tmc3 UTSW 7 83622396 missense probably benign 0.05
R4789:Tmc3 UTSW 7 83622538 missense probably damaging 0.99
R4998:Tmc3 UTSW 7 83622321 missense probably benign 0.16
R5044:Tmc3 UTSW 7 83609118 missense probably benign 0.00
R5108:Tmc3 UTSW 7 83619948 missense probably damaging 0.97
R5119:Tmc3 UTSW 7 83615010 missense probably damaging 1.00
R5428:Tmc3 UTSW 7 83612547 missense probably damaging 1.00
R5447:Tmc3 UTSW 7 83622361 missense possibly damaging 0.63
R5767:Tmc3 UTSW 7 83599982 missense probably benign 0.43
R5801:Tmc3 UTSW 7 83622478 missense possibly damaging 0.94
R6115:Tmc3 UTSW 7 83614962 missense possibly damaging 0.47
R6193:Tmc3 UTSW 7 83603335 missense probably benign 0.26
R6436:Tmc3 UTSW 7 83598487 missense probably damaging 1.00
R6478:Tmc3 UTSW 7 83622316 missense probably benign 0.31
R6849:Tmc3 UTSW 7 83586357 missense probably damaging 1.00
R7030:Tmc3 UTSW 7 83616817 splice site probably null
R7085:Tmc3 UTSW 7 83622145 missense possibly damaging 0.88
R7574:Tmc3 UTSW 7 83598273 missense probably damaging 0.99
R7685:Tmc3 UTSW 7 83597458 missense probably damaging 1.00
R7888:Tmc3 UTSW 7 83600009 missense probably damaging 1.00
R8474:Tmc3 UTSW 7 83609914 missense probably damaging 1.00
R8961:Tmc3 UTSW 7 83607762 missense probably damaging 1.00
V7581:Tmc3 UTSW 7 83622505 missense probably benign 0.01
Z1088:Tmc3 UTSW 7 83603468 missense probably damaging 1.00
Z1188:Tmc3 UTSW 7 83612478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTATACAGAACCAGGGACC -3'
(R):5'- CACATGGCCACTTTGAGTAGTG -3'

Sequencing Primer
(F):5'- GGCACCATATGACATCACTCTTC -3'
(R):5'- CACTTTGAGTAGTGGTGACTAAGTC -3'
Posted On2018-06-22