Incidental Mutation 'R6585:Nprl3'
List |< first << previous [record 19 of 31] next >> last >|
ID524355
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Namenitrogen permease regulator-like 3
SynonymsProx1, HS-26, Phg, -14 gene, HS-40, Mare, m(alpha)RE
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R6585 (G1)
Quality Score212.009
Status Validated
Chromosome11
Chromosomal Location32225628-32267707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32234812 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 399 (R399Q)
Ref Sequence ENSEMBL: ENSMUSP00000105016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020528] [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000138050] [ENSMUST00000141859] [ENSMUST00000142964]
Predicted Effect probably benign
Transcript: ENSMUST00000020528
SMART Domains Protein: ENSMUSP00000020528
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:Pur_DNA_glyco 109 304 1.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020530
AA Change: R424Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: R424Q

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109389
AA Change: R399Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: R399Q

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109390
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129573
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138050
SMART Domains Protein: ENSMUSP00000121960
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142964
SMART Domains Protein: ENSMUSP00000118208
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148636
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32267539 start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32248230 intron probably benign
IGL03366:Nprl3 APN 11 32250256 missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32239784 unclassified probably benign
R0555:Nprl3 UTSW 11 32233118 critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32234876 missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32232973 missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32234894 missense probably benign 0.00
R2884:Nprl3 UTSW 11 32248163 missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32255464 missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32233082 missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32234906 missense probably benign 0.00
R6052:Nprl3 UTSW 11 32255453 missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32267432 missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32239828 missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32234812 missense probably benign
R6774:Nprl3 UTSW 11 32237381 missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32267509 missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32248150 nonsense probably null
R7980:Nprl3 UTSW 11 32237357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAACAGTACCCAGGCTTC -3'
(R):5'- CTTCCCGTTTAGGTACTGGG -3'

Sequencing Primer
(F):5'- AACAGTACCCAGGCTTCTTGGATG -3'
(R):5'- TCCCCAGGAATAGGAATCTGTTC -3'
Posted On2018-06-22