Incidental Mutation 'R6585:Agr2'
ID 524357
Institutional Source Beutler Lab
Gene Symbol Agr2
Ensembl Gene ENSMUSG00000020581
Gene Name anterior gradient 2
Synonyms XAG-2, mAG-2, Gob-4, HAG-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock # R6585 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 35992907-36004087 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35995626 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 37 (R37Q)
Ref Sequence ENSEMBL: ENSMUSP00000020898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020898]
AlphaFold O88312
Predicted Effect probably benign
Transcript: ENSMUST00000020898
AA Change: R37Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020898
Gene: ENSMUSG00000020581
AA Change: R37Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin_7 53 133 1.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147861
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This protein plays a role in cell migration, cellular transformation and metastasis and is as a p53 inhibitor. As an ER-localized molecular chaperone, it plays a role in the folding, trafficking, and assembly of cysteine-rich transmembrane receptors and the cysteine-rich intestinal gylcoprotein mucin. This gene has been implicated in inflammatory bowel disease and cancer progression. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit colitis and increased susceptibility to induced colitis. Mice homozygous for another knock-out allele exhibit hyperplasia and defective lineage maturation in the stomach that leads to intestinal obstruction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Agr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Agr2 APN 12 35995581 missense possibly damaging 0.63
IGL02081:Agr2 APN 12 35995656 critical splice donor site probably null
IGL03190:Agr2 APN 12 35998635 missense probably damaging 1.00
IGL02835:Agr2 UTSW 12 35995904 missense probably benign 0.23
R5514:Agr2 UTSW 12 35996091 missense probably benign
R5894:Agr2 UTSW 12 35995510 splice site probably benign
R6196:Agr2 UTSW 12 35995592 nonsense probably null
R6584:Agr2 UTSW 12 35995626 missense probably benign
R6850:Agr2 UTSW 12 35995559 missense probably benign
R7384:Agr2 UTSW 12 35995924 missense probably damaging 0.98
R7459:Agr2 UTSW 12 35997453 missense probably benign 0.20
R7533:Agr2 UTSW 12 35996129 critical splice donor site probably null
R7567:Agr2 UTSW 12 35995947 missense probably benign 0.00
R8039:Agr2 UTSW 12 35995559 missense probably benign 0.10
R8118:Agr2 UTSW 12 35996107 missense probably benign 0.45
R9026:Agr2 UTSW 12 35996092 missense probably benign 0.03
R9031:Agr2 UTSW 12 35995566 missense probably benign
R9063:Agr2 UTSW 12 36003899 makesense probably null
R9259:Agr2 UTSW 12 36003864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACCACTGCGATAGACTCTG -3'
(R):5'- CAGAGTTTCAGGCCCAAACC -3'

Sequencing Primer
(F):5'- ACCACTGCGATAGACTCTGTAATTC -3'
(R):5'- CCTGCTGAGCCTGGATAATAGATAC -3'
Posted On 2018-06-22