Mutagenetix > Incidental Mutations

Incidental Mutation 'R6585:Agr2'

524357

Institutional Source

Beutler Lab

Gene Symbol

Agr2

Ensembl Gene

ENSMUSG00000020581

Gene Name

anterior gradient 2

Synonyms

XAG-2, mAG-2, Gob-4, HAG-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.482) question?

Stock #

R6585 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35992907-36004087 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 35995626 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 37 (R37Q)

Ref Sequence

ENSEMBL: ENSMUSP00000020898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020898]

Predicted Effect

probably benign
Transcript: ENSMUST00000020898
AA Change: R37Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020898
Gene: ENSMUSG00000020581
AA Change: R37Q

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Thioredoxin_7	53	133	1.9e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147861

Meta Mutation Damage Score

0.0624

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This protein plays a role in cell migration, cellular transformation and metastasis and is as a p53 inhibitor. As an ER-localized molecular chaperone, it plays a role in the folding, trafficking, and assembly of cysteine-rich transmembrane receptors and the cysteine-rich intestinal gylcoprotein mucin. This gene has been implicated in inflammatory bowel disease and cancer progression. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit colitis and increased susceptibility to induced colitis. Mice homozygous for another knock-out allele exhibit hyperplasia and defective lineage maturation in the stomach that leads to intestinal obstruction and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,737,668	C108Y	probably damaging	Het
AA792892	C	T	5: 94,381,556	P62S	probably benign	Het
Adam1b	G	T	5: 121,501,187	D598E	probably benign	Het
Ascc3	A	G	10: 50,842,177	K1989E	probably benign	Het
Chd1l	A	G	3: 97,597,772	F160L	probably damaging	Het
Ciita	T	A	16: 10,511,745	V628E	probably benign	Het
Dis3l2	T	A	1: 86,745,494	I69N	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Elp2	T	C	18: 24,625,549	L503S	probably damaging	Het
Fcgbp	A	T	7: 28,113,979	Q2313L	possibly damaging	Het
Gm14851	A	G	8: 21,095,232	C65R	possibly damaging	Het
Gpr155	A	T	2: 73,349,645	I157N	probably damaging	Het
Hist2h2bb	A	T	3: 96,270,097	T116S	probably benign	Het
Kcnj1	T	C	9: 32,397,261	V307A	probably benign	Het
Lama3	G	A	18: 12,419,257		probably null	Het
Lrp6	A	T	6: 134,507,558	Y367*	probably null	Het
Ms4a14	T	A	19: 11,303,645	Q516H	unknown	Het
Nprl3	C	T	11: 32,234,812	R399Q	probably benign	Het
Olfr273	A	T	4: 52,856,192	M107K	possibly damaging	Het
Olfr290	A	T	7: 84,916,462	I228F	probably damaging	Het
Park7	G	T	4: 150,905,264	Q80K	probably benign	Het
Pramef20	C	A	4: 144,377,030	L175F	possibly damaging	Het
Ptgs2	T	C	1: 150,103,987	V281A	possibly damaging	Het
Rprd1a	T	C	18: 24,506,663		probably null	Het
Speer4f2	A	G	5: 17,374,422	E73G	probably damaging	Het
Spta1	T	C	1: 174,178,685	W138R	probably damaging	Het
U2surp	T	C	9: 95,472,071	E838G	probably damaging	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp19	G	T	9: 108,499,727	L1165F	probably damaging	Het
Zfp27	G	A	7: 29,896,393	T49I	possibly damaging	Het

Other mutations in Agr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01284:Agr2	APN	12	35995581	missense	possibly damaging	0.63
IGL02081:Agr2	APN	12	35995656	critical splice donor site	probably null
IGL03190:Agr2	APN	12	35998635	missense	probably damaging	1.00
IGL02835:Agr2	UTSW	12	35995904	missense	probably benign	0.23
R5514:Agr2	UTSW	12	35996091	missense	probably benign
R5894:Agr2	UTSW	12	35995510	splice site	probably benign
R6196:Agr2	UTSW	12	35995592	nonsense	probably null
R6584:Agr2	UTSW	12	35995626	missense	probably benign
R6850:Agr2	UTSW	12	35995559	missense	probably benign
R7384:Agr2	UTSW	12	35995924	missense	probably damaging	0.98
R7459:Agr2	UTSW	12	35997453	missense	probably benign	0.20
R7533:Agr2	UTSW	12	35996129	critical splice donor site	probably null
R7567:Agr2	UTSW	12	35995947	missense	probably benign	0.00
R8039:Agr2	UTSW	12	35995559	missense	probably benign	0.10
R8118:Agr2	UTSW	12	35996107	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- TCCACCACTGCGATAGACTCTG -3'
(R):5'- CAGAGTTTCAGGCCCAAACC -3'

Sequencing Primer
(F):5'- ACCACTGCGATAGACTCTGTAATTC -3'
(R):5'- CCTGCTGAGCCTGGATAATAGATAC -3'

Posted On

2018-06-22