Mutagenetix > Incidental Mutation

Incidental Mutation 'R6585:Ciita'

524359

Institutional Source

Beutler Lab

Gene Symbol

Ciita

Ensembl Gene

ENSMUSG00000022504

Gene Name

class II transactivator

Synonyms

C2ta, Gm9475

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6585 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10480059-10528418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 10511745 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 628 (V628E)

Ref Sequence

ENSEMBL: ENSMUSP00000154946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023147] [ENSMUST00000184863] [ENSMUST00000230146] [ENSMUST00000230395] [ENSMUST00000230450]

AlphaFold

P79621

Predicted Effect

probably benign
Transcript: ENSMUST00000023147
AA Change: V631E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000023147
Gene: ENSMUSG00000022504
AA Change: V631E

Domain	Start	End	E-Value	Type
low complexity region	216	230	N/A	INTRINSIC
Pfam:NACHT	362	533	1.8e-44	PFAM
low complexity region	847	861	N/A	INTRINSIC
LRR	931	961	8.53e0	SMART
LRR	962	989	7.37e-4	SMART
LRR	991	1018	1.25e-6	SMART
LRR	1019	1046	2.36e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184863

SMART Domains

Protein: ENSMUSP00000139108
Gene: ENSMUSG00000038055

Domain	Start	End	E-Value	Type
Pfam:Dexa_ind	1	95	4.6e-58	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229906

Predicted Effect

probably benign
Transcript: ENSMUST00000230146
AA Change: V628E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000230395
AA Change: V708E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000230450
AA Change: V607E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230533

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: This gene encodes a member of the NOD-like receptor protein family. This protein acts as a transcriptional coactivator and component of the enhanceosome complex to stimulate transcription of MHC class II genes in the adaptive immune response. This protein may also regulate the transcription of MHC class I genes. Mutations in the human gene have been linked to a rare immunodeficiency, bare lymphocyte syndrome, and homozygous knockout mice exhibit many features of this disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are immunologically abnormal with extremely little MHC class II expression, greatly reduced serum IgG, and impaired T-dependent antigen responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,737,668	C108Y	probably damaging	Het
AA792892	C	T	5: 94,381,556	P62S	probably benign	Het
Adam1b	G	T	5: 121,501,187	D598E	probably benign	Het
Agr2	G	A	12: 35,995,626	R37Q	probably benign	Het
Ascc3	A	G	10: 50,842,177	K1989E	probably benign	Het
Chd1l	A	G	3: 97,597,772	F160L	probably damaging	Het
Dis3l2	T	A	1: 86,745,494	I69N	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Elp2	T	C	18: 24,625,549	L503S	probably damaging	Het
Fcgbp	A	T	7: 28,113,979	Q2313L	possibly damaging	Het
Gm14851	A	G	8: 21,095,232	C65R	possibly damaging	Het
Gpr155	A	T	2: 73,349,645	I157N	probably damaging	Het
Hist2h2bb	A	T	3: 96,270,097	T116S	probably benign	Het
Kcnj1	T	C	9: 32,397,261	V307A	probably benign	Het
Lama3	G	A	18: 12,419,257		probably null	Het
Lrp6	A	T	6: 134,507,558	Y367*	probably null	Het
Ms4a14	T	A	19: 11,303,645	Q516H	unknown	Het
Nprl3	C	T	11: 32,234,812	R399Q	probably benign	Het
Olfr273	A	T	4: 52,856,192	M107K	possibly damaging	Het
Olfr290	A	T	7: 84,916,462	I228F	probably damaging	Het
Park7	G	T	4: 150,905,264	Q80K	probably benign	Het
Pramef20	C	A	4: 144,377,030	L175F	possibly damaging	Het
Ptgs2	T	C	1: 150,103,987	V281A	possibly damaging	Het
Rprd1a	T	C	18: 24,506,663		probably null	Het
Speer4f2	A	G	5: 17,374,422	E73G	probably damaging	Het
Spta1	T	C	1: 174,178,685	W138R	probably damaging	Het
U2surp	T	C	9: 95,472,071	E838G	probably damaging	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp19	G	T	9: 108,499,727	L1165F	probably damaging	Het
Zfp27	G	A	7: 29,896,393	T49I	possibly damaging	Het

Other mutations in Ciita

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01348:Ciita	APN	16	10510727	missense	probably damaging	0.99
IGL01830:Ciita	APN	16	10521051	missense	probably damaging	1.00
IGL02557:Ciita	APN	16	10512015	missense	probably damaging	1.00
IGL02634:Ciita	APN	16	10508713	missense	probably damaging	1.00
IGL03057:Ciita	APN	16	10520959	splice site	probably benign
IGL03403:Ciita	APN	16	10503872	missense	probably damaging	1.00
deshabille	UTSW	16	10509207	splice site	probably null
oddball	UTSW	16	10503948	critical splice donor site	probably null
sisal	UTSW	16	10513288	critical splice donor site	probably null
R0001:Ciita	UTSW	16	10514433	splice site	probably benign
R0138:Ciita	UTSW	16	10512270	missense	probably damaging	1.00
R0583:Ciita	UTSW	16	10523804	critical splice donor site	probably null
R1468:Ciita	UTSW	16	10513288	critical splice donor site	probably null
R1468:Ciita	UTSW	16	10513288	critical splice donor site	probably null
R1470:Ciita	UTSW	16	10514468	missense	possibly damaging	0.75
R1470:Ciita	UTSW	16	10514468	missense	possibly damaging	0.75
R1888:Ciita	UTSW	16	10511084	missense	probably damaging	1.00
R1888:Ciita	UTSW	16	10511084	missense	probably damaging	1.00
R2017:Ciita	UTSW	16	10511676	missense	probably damaging	1.00
R2072:Ciita	UTSW	16	10518353	missense	probably benign	0.16
R2410:Ciita	UTSW	16	10510704	missense	probably damaging	0.99
R4779:Ciita	UTSW	16	10511366	missense	probably damaging	1.00
R5151:Ciita	UTSW	16	10523730	missense	probably damaging	1.00
R5233:Ciita	UTSW	16	10509401	missense	possibly damaging	0.95
R5363:Ciita	UTSW	16	10512167	missense	probably damaging	1.00
R5431:Ciita	UTSW	16	10523792	missense	probably damaging	1.00
R5821:Ciita	UTSW	16	10511805	missense	possibly damaging	0.77
R6085:Ciita	UTSW	16	10512165	missense	probably benign	0.08
R6088:Ciita	UTSW	16	10511931	missense	probably damaging	1.00
R6241:Ciita	UTSW	16	10511903	missense	probably damaging	1.00
R6354:Ciita	UTSW	16	10523746	missense	probably damaging	1.00
R6502:Ciita	UTSW	16	10511910	missense	probably damaging	1.00
R6553:Ciita	UTSW	16	10511745	missense	probably benign	0.00
R6916:Ciita	UTSW	16	10509207	splice site	probably null
R6937:Ciita	UTSW	16	10512491	splice site	probably null
R7007:Ciita	UTSW	16	10511307	missense	probably damaging	1.00
R7219:Ciita	UTSW	16	10512257	missense	probably benign	0.00
R7326:Ciita	UTSW	16	10512288	missense	probably damaging	1.00
R8314:Ciita	UTSW	16	10510988	missense	probably damaging	0.99
R8772:Ciita	UTSW	16	10480162	missense	probably damaging	1.00
R9102:Ciita	UTSW	16	10506701	missense	probably benign	0.00
R9213:Ciita	UTSW	16	10501878	missense	probably damaging	1.00
R9290:Ciita	UTSW	16	10508649	missense	probably damaging	1.00
R9296:Ciita	UTSW	16	10503948	critical splice donor site	probably null
R9329:Ciita	UTSW	16	10506707	missense	probably damaging	0.98
R9418:Ciita	UTSW	16	10501901	nonsense	probably null
R9496:Ciita	UTSW	16	10480145	start codon destroyed	probably null	1.00
R9529:Ciita	UTSW	16	10510776	missense	probably benign	0.44
RF019:Ciita	UTSW	16	10506747	missense	probably damaging	0.98
Z1176:Ciita	UTSW	16	10508700	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCTATAGTCACAGCCCTGTTG -3'
(R):5'- TTCTTCCTCGGAGTCAAGGC -3'

Sequencing Primer
(F):5'- TGTGTGCCAGCTCTCCAAG -3'
(R):5'- TCGGAGTCAAGGCCAGGTAC -3'

Posted On

2018-06-22