Incidental Mutation 'R6585:Elp2'
ID524363
Institutional Source Beutler Lab
Gene Symbol Elp2
Ensembl Gene ENSMUSG00000024271
Gene Nameelongator acetyltransferase complex subunit 2
SynonymsStatip1, StIP1, Stat3-interacting protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location24603961-24638830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24625549 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 503 (L503S)
Ref Sequence ENSEMBL: ENSMUSP00000025120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025120]
Predicted Effect probably damaging
Transcript: ENSMUST00000025120
AA Change: L503S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025120
Gene: ENSMUSG00000024271
AA Change: L503S

DomainStartEndE-ValueType
WD40 47 91 1.06e-3 SMART
WD40 94 143 2.24e-2 SMART
WD40 196 237 4.69e-5 SMART
WD40 271 319 2.44e-3 SMART
Blast:WD40 329 368 1e-20 BLAST
WD40 376 415 2.12e-3 SMART
WD40 429 467 1.71e1 SMART
WD40 556 600 7.43e-1 SMART
WD40 603 642 1.93e-6 SMART
WD40 661 697 1.55e-5 SMART
Blast:WD40 709 753 7e-21 BLAST
WD40 766 825 1.92e0 SMART
Meta Mutation Damage Score 0.9719 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core subunit of the elongator complex, a histone acetyltransferase complex that associates with RNA polymerase II. In addition to histone acetylation, the encoded protein effects transcriptional elongation and may help remodel chromatin. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Elp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Elp2 APN 18 24617491 missense probably benign 0.01
IGL01909:Elp2 APN 18 24619519 splice site probably benign
IGL01974:Elp2 APN 18 24626203 missense probably damaging 0.99
IGL02243:Elp2 APN 18 24622606 missense probably benign 0.11
IGL03049:Elp2 APN 18 24631459 missense probably benign 0.05
IGL03236:Elp2 APN 18 24622243 splice site probably benign
IGL03380:Elp2 APN 18 24622480 missense probably benign 0.05
Camelid UTSW 18 24625549 missense probably damaging 1.00
PIT4283001:Elp2 UTSW 18 24622130 missense probably damaging 1.00
PIT4531001:Elp2 UTSW 18 24604113 missense probably damaging 0.99
R0119:Elp2 UTSW 18 24634409 missense probably benign 0.03
R0244:Elp2 UTSW 18 24631471 missense possibly damaging 0.81
R0299:Elp2 UTSW 18 24634409 missense probably benign 0.03
R0609:Elp2 UTSW 18 24626156 missense probably benign
R0671:Elp2 UTSW 18 24612442 splice site probably benign
R1531:Elp2 UTSW 18 24631404 missense probably benign 0.06
R1658:Elp2 UTSW 18 24617413 missense probably benign 0.27
R1673:Elp2 UTSW 18 24611926 missense possibly damaging 0.93
R2012:Elp2 UTSW 18 24631458 missense probably benign 0.00
R3861:Elp2 UTSW 18 24606920 missense probably benign 0.01
R4038:Elp2 UTSW 18 24634348 missense probably damaging 1.00
R4396:Elp2 UTSW 18 24609650 missense probably damaging 1.00
R4507:Elp2 UTSW 18 24626120 splice site probably null
R4901:Elp2 UTSW 18 24619485 missense probably damaging 1.00
R5389:Elp2 UTSW 18 24606903 missense possibly damaging 0.87
R5511:Elp2 UTSW 18 24612450 nonsense probably null
R5633:Elp2 UTSW 18 24615210 missense probably damaging 1.00
R5728:Elp2 UTSW 18 24617452 missense probably damaging 1.00
R6855:Elp2 UTSW 18 24606877 missense possibly damaging 0.48
R6877:Elp2 UTSW 18 24634976 missense probably benign 0.00
R7145:Elp2 UTSW 18 24604069 missense probably benign 0.42
R7163:Elp2 UTSW 18 24614446 missense probably benign 0.00
R7313:Elp2 UTSW 18 24609659 missense probably benign 0.05
R7318:Elp2 UTSW 18 24606899 missense probably damaging 1.00
R7403:Elp2 UTSW 18 24619485 missense probably damaging 1.00
R7497:Elp2 UTSW 18 24611928 missense probably damaging 0.96
R8017:Elp2 UTSW 18 24606863 missense possibly damaging 0.93
R8019:Elp2 UTSW 18 24606863 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGACCTGTCTGTTGGAAAG -3'
(R):5'- ACTGTTCCTGTGTCAGTGGC -3'

Sequencing Primer
(F):5'- AAAGGGATTGCTTGGAGTGGC -3'
(R):5'- CTGTGTCAGTGGCTACATGAGAATAG -3'
Posted On2018-06-22