Incidental Mutation 'R6648:Olfr1378'
ID524368
Institutional Source Beutler Lab
Gene Symbol Olfr1378
Ensembl Gene ENSMUSG00000050343
Gene Nameolfactory receptor 1378
SynonymsGA_x6K02T2QP88-4469162-4468215, MOR129-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6648 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50966530-50973113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50969173 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 52 (D52N)
Ref Sequence ENSEMBL: ENSMUSP00000149432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052285] [ENSMUST00000213259]
Predicted Effect probably damaging
Transcript: ENSMUST00000052285
AA Change: D52N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058119
Gene: ENSMUSG00000050343
AA Change: D52N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.1e-54 PFAM
Pfam:7tm_1 41 289 1.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213259
AA Change: D52N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4145 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Olfr1378
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Olfr1378 APN 11 50969119 missense probably benign 0.00
PIT4243001:Olfr1378 UTSW 11 50969552 missense probably damaging 1.00
R0540:Olfr1378 UTSW 11 50969843 missense possibly damaging 0.96
R0607:Olfr1378 UTSW 11 50969843 missense possibly damaging 0.96
R0699:Olfr1378 UTSW 11 50969818 missense probably damaging 1.00
R0719:Olfr1378 UTSW 11 50969934 nonsense probably null
R2117:Olfr1378 UTSW 11 50969320 missense probably damaging 0.98
R2263:Olfr1378 UTSW 11 50969869 missense possibly damaging 0.75
R3402:Olfr1378 UTSW 11 50969068 missense probably benign
R3767:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R3768:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R3769:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R4293:Olfr1378 UTSW 11 50969426 missense probably damaging 1.00
R4409:Olfr1378 UTSW 11 50969396 missense probably damaging 1.00
R4446:Olfr1378 UTSW 11 50969863 missense probably damaging 1.00
R4731:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R4732:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R4733:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R5437:Olfr1378 UTSW 11 50969108 missense probably benign 0.02
R6085:Olfr1378 UTSW 11 50969123 missense probably damaging 1.00
R7419:Olfr1378 UTSW 11 50969325 nonsense probably null
R7686:Olfr1378 UTSW 11 50969755 missense possibly damaging 0.92
R8440:Olfr1378 UTSW 11 50969197 missense probably damaging 1.00
X0011:Olfr1378 UTSW 11 50969654 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCAATCATACCTGGCAATGG -3'
(R):5'- ATAGGCCATCACACTCAGGAGG -3'

Sequencing Primer
(F):5'- CATACCTGGCAATGGAACTTTC -3'
(R):5'- GAAGCCATCCATGTTGATGAATGTG -3'
Posted On2018-06-22