Incidental Mutation 'R6586:Cnga3'
ID 524371
Institutional Source Beutler Lab
Gene Symbol Cnga3
Ensembl Gene ENSMUSG00000026114
Gene Name cyclic nucleotide gated channel alpha 3
Synonyms CNG3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6586 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 37214434-37263384 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37261278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 398 (S398P)
Ref Sequence ENSEMBL: ENSMUSP00000142175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027288] [ENSMUST00000194195] [ENSMUST00000195272]
AlphaFold Q9JJZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000027288
AA Change: S360P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027288
Gene: ENSMUSG00000026114
AA Change: S360P

DomainStartEndE-ValueType
Pfam:Ion_trans 109 351 1.3e-30 PFAM
cNMP 423 547 2.5e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000194195
AA Change: S360P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142075
Gene: ENSMUSG00000026114
AA Change: S360P

DomainStartEndE-ValueType
Pfam:Ion_trans 146 340 1.3e-15 PFAM
cNMP 423 547 2.4e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000195272
AA Change: S398P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142175
Gene: ENSMUSG00000026114
AA Change: S398P

DomainStartEndE-ValueType
Pfam:Ion_trans 184 378 1.5e-15 PFAM
cNMP 461 585 2.4e-28 SMART
PDB:3SWY|C 605 648 3e-14 PDB
Meta Mutation Damage Score 0.2668 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclic nucleotide-gated cation channel protein family which is required for normal vision and olfactory signal transduction. Mutations in this gene are associated with achromatopsia (rod monochromacy) and color blindness. Two alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals experience progressive loss of cone photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,328 F265L possibly damaging Het
9930022D16Rik A G 11: 109,417,960 T51A unknown Het
Acaa1a A G 9: 119,349,538 probably null Het
Clasp2 T C 9: 113,813,264 S280P probably damaging Het
Cngb3 T G 4: 19,280,946 L5R probably damaging Het
Cyp2c65 T C 19: 39,082,218 F282L possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnm2 T C 9: 21,505,646 F825S probably benign Het
Dusp27 T C 1: 166,100,885 E386G possibly damaging Het
Egfem1 T A 3: 29,662,411 C343* probably null Het
Fah T A 7: 84,593,260 D280V probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Flg A T 3: 93,292,983 probably benign Het
Flnb A G 14: 7,929,138 R1956G possibly damaging Het
Mterf2 A G 10: 85,120,106 F218S probably damaging Het
Nlrp1a A G 11: 71,106,073 V868A probably benign Het
Nrip2 T A 6: 128,404,948 C85* probably null Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr620 T A 7: 103,611,976 I126F possibly damaging Het
Palm A C 10: 79,809,531 N111H probably benign Het
Pipox T C 11: 77,881,179 D373G possibly damaging Het
Plec C T 15: 76,175,087 G3540D probably damaging Het
Psd3 T C 8: 67,963,545 T567A probably damaging Het
Psg28 T C 7: 18,430,544 Y81C probably damaging Het
Rarres1 A T 3: 67,491,033 N131K probably damaging Het
Rbbp8nl G A 2: 180,280,959 H214Y probably damaging Het
Tas2r135 A G 6: 42,406,018 T164A probably benign Het
Tmco3 G T 8: 13,320,894 probably benign Het
Tnpo2 T A 8: 85,045,202 M259K possibly damaging Het
Tns4 T C 11: 99,080,267 R206G probably benign Het
Trim60 G T 8: 65,000,596 L334I possibly damaging Het
Ttn T C 2: 76,730,410 T29216A probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn1r60 T A 7: 5,544,447 N218I probably benign Het
Vps25 T G 11: 101,259,009 V125G probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Ythdf2 A T 4: 132,205,600 M83K probably benign Het
Other mutations in Cnga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Cnga3 APN 1 37260793 missense possibly damaging 0.89
IGL01677:Cnga3 APN 1 37244918 nonsense probably null
IGL02475:Cnga3 APN 1 37257991 critical splice acceptor site probably null
IGL03145:Cnga3 APN 1 37261674 missense probably damaging 1.00
R1557:Cnga3 UTSW 1 37260985 missense probably damaging 1.00
R1622:Cnga3 UTSW 1 37244828 splice site probably benign
R1678:Cnga3 UTSW 1 37261498 missense possibly damaging 0.94
R1938:Cnga3 UTSW 1 37261873 missense possibly damaging 0.95
R2968:Cnga3 UTSW 1 37261078 missense probably damaging 1.00
R2969:Cnga3 UTSW 1 37261078 missense probably damaging 1.00
R3406:Cnga3 UTSW 1 37262065 missense probably benign 0.00
R3694:Cnga3 UTSW 1 37261740 missense probably damaging 1.00
R4079:Cnga3 UTSW 1 37241865 missense possibly damaging 0.70
R4850:Cnga3 UTSW 1 37258006 nonsense probably null
R4907:Cnga3 UTSW 1 37241942 critical splice donor site probably null
R5802:Cnga3 UTSW 1 37260925 missense probably damaging 0.98
R6135:Cnga3 UTSW 1 37232237 start gained probably benign
R6997:Cnga3 UTSW 1 37244884 missense probably benign 0.34
R7630:Cnga3 UTSW 1 37258046 missense probably damaging 1.00
R7799:Cnga3 UTSW 1 37261771 missense probably damaging 1.00
R8552:Cnga3 UTSW 1 37244979 missense probably benign
R8859:Cnga3 UTSW 1 37260771 missense possibly damaging 0.91
R8968:Cnga3 UTSW 1 37261379 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CGACTCTCCCGGAAGTACATTTAC -3'
(R):5'- ACCTTCTTCAGCGTGTCCAG -3'

Sequencing Primer
(F):5'- CCGGAAGTACATTTACAGTCTCTAC -3'
(R):5'- CAGGTGCACGTTGATGGC -3'
Posted On 2018-06-22