Incidental Mutation 'R6586:Cnga3'
ID 524371
Institutional Source Beutler Lab
Gene Symbol Cnga3
Ensembl Gene ENSMUSG00000026114
Gene Name cyclic nucleotide gated channel alpha 3
Synonyms CNG3
MMRRC Submission 044710-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6586 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 37257317-37302465 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37300359 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 398 (S398P)
Ref Sequence ENSEMBL: ENSMUSP00000142175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027288] [ENSMUST00000194195] [ENSMUST00000195272]
AlphaFold Q9JJZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000027288
AA Change: S360P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027288
Gene: ENSMUSG00000026114
AA Change: S360P

DomainStartEndE-ValueType
Pfam:Ion_trans 109 351 1.3e-30 PFAM
cNMP 423 547 2.5e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000194195
AA Change: S360P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142075
Gene: ENSMUSG00000026114
AA Change: S360P

DomainStartEndE-ValueType
Pfam:Ion_trans 146 340 1.3e-15 PFAM
cNMP 423 547 2.4e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000195272
AA Change: S398P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142175
Gene: ENSMUSG00000026114
AA Change: S398P

DomainStartEndE-ValueType
Pfam:Ion_trans 184 378 1.5e-15 PFAM
cNMP 461 585 2.4e-28 SMART
PDB:3SWY|C 605 648 3e-14 PDB
Meta Mutation Damage Score 0.2668 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclic nucleotide-gated cation channel protein family which is required for normal vision and olfactory signal transduction. Mutations in this gene are associated with achromatopsia (rod monochromacy) and color blindness. Two alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals experience progressive loss of cone photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,182,639 (GRCm39) F265L possibly damaging Het
9930022D16Rik A G 11: 109,308,786 (GRCm39) T51A unknown Het
Acaa1a A G 9: 119,178,604 (GRCm39) probably null Het
Clasp2 T C 9: 113,642,332 (GRCm39) S280P probably damaging Het
Cngb3 T G 4: 19,280,946 (GRCm39) L5R probably damaging Het
Cyp2c65 T C 19: 39,070,662 (GRCm39) F282L possibly damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dnm2 T C 9: 21,416,942 (GRCm39) F825S probably benign Het
Egfem1 T A 3: 29,716,560 (GRCm39) C343* probably null Het
Fah T A 7: 84,242,468 (GRCm39) D280V probably benign Het
Fiz1 C T 7: 5,011,400 (GRCm39) A373T possibly damaging Het
Flg A T 3: 93,200,290 (GRCm39) probably benign Het
Flnb A G 14: 7,929,138 (GRCm38) R1956G possibly damaging Het
Mterf2 A G 10: 84,955,970 (GRCm39) F218S probably damaging Het
Nlrp1a A G 11: 70,996,899 (GRCm39) V868A probably benign Het
Nrip2 T A 6: 128,381,911 (GRCm39) C85* probably null Het
Ogfrl1 T G 1: 23,408,944 (GRCm39) K427N probably benign Het
Or1o1 G A 17: 37,716,796 (GRCm39) R119H probably benign Het
Or51v14 T A 7: 103,261,183 (GRCm39) I126F possibly damaging Het
Palm A C 10: 79,645,365 (GRCm39) N111H probably benign Het
Pipox T C 11: 77,772,005 (GRCm39) D373G possibly damaging Het
Plec C T 15: 76,059,287 (GRCm39) G3540D probably damaging Het
Psd3 T C 8: 68,416,197 (GRCm39) T567A probably damaging Het
Psg28 T C 7: 18,164,469 (GRCm39) Y81C probably damaging Het
Rarres1 A T 3: 67,398,366 (GRCm39) N131K probably damaging Het
Rbbp8nl G A 2: 179,922,752 (GRCm39) H214Y probably damaging Het
Styxl2 T C 1: 165,928,454 (GRCm39) E386G possibly damaging Het
Tas2r135 A G 6: 42,382,952 (GRCm39) T164A probably benign Het
Tmco3 G T 8: 13,370,894 (GRCm39) probably benign Het
Tnpo2 T A 8: 85,771,831 (GRCm39) M259K possibly damaging Het
Tns4 T C 11: 98,971,093 (GRCm39) R206G probably benign Het
Trim60 G T 8: 65,453,248 (GRCm39) L334I possibly damaging Het
Ttn T C 2: 76,560,754 (GRCm39) T29216A probably damaging Het
Urb2 G T 8: 124,757,864 (GRCm39) E1190D probably damaging Het
Vmn1r60 T A 7: 5,547,446 (GRCm39) N218I probably benign Het
Vps25 T G 11: 101,149,835 (GRCm39) V125G probably damaging Het
Ythdc2 A G 18: 44,978,855 (GRCm39) D455G probably benign Het
Ythdf2 A T 4: 131,932,911 (GRCm39) M83K probably benign Het
Other mutations in Cnga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Cnga3 APN 1 37,299,874 (GRCm39) missense possibly damaging 0.89
IGL01677:Cnga3 APN 1 37,283,999 (GRCm39) nonsense probably null
IGL02475:Cnga3 APN 1 37,297,072 (GRCm39) critical splice acceptor site probably null
IGL03145:Cnga3 APN 1 37,300,755 (GRCm39) missense probably damaging 1.00
R1557:Cnga3 UTSW 1 37,300,066 (GRCm39) missense probably damaging 1.00
R1622:Cnga3 UTSW 1 37,283,909 (GRCm39) splice site probably benign
R1678:Cnga3 UTSW 1 37,300,579 (GRCm39) missense possibly damaging 0.94
R1938:Cnga3 UTSW 1 37,300,954 (GRCm39) missense possibly damaging 0.95
R2968:Cnga3 UTSW 1 37,300,159 (GRCm39) missense probably damaging 1.00
R2969:Cnga3 UTSW 1 37,300,159 (GRCm39) missense probably damaging 1.00
R3406:Cnga3 UTSW 1 37,301,146 (GRCm39) missense probably benign 0.00
R3694:Cnga3 UTSW 1 37,300,821 (GRCm39) missense probably damaging 1.00
R4079:Cnga3 UTSW 1 37,280,946 (GRCm39) missense possibly damaging 0.70
R4850:Cnga3 UTSW 1 37,297,087 (GRCm39) nonsense probably null
R4907:Cnga3 UTSW 1 37,281,023 (GRCm39) critical splice donor site probably null
R5802:Cnga3 UTSW 1 37,300,006 (GRCm39) missense probably damaging 0.98
R6135:Cnga3 UTSW 1 37,271,318 (GRCm39) start gained probably benign
R6997:Cnga3 UTSW 1 37,283,965 (GRCm39) missense probably benign 0.34
R7630:Cnga3 UTSW 1 37,297,127 (GRCm39) missense probably damaging 1.00
R7799:Cnga3 UTSW 1 37,300,852 (GRCm39) missense probably damaging 1.00
R8552:Cnga3 UTSW 1 37,284,060 (GRCm39) missense probably benign
R8859:Cnga3 UTSW 1 37,299,852 (GRCm39) missense possibly damaging 0.91
R8968:Cnga3 UTSW 1 37,300,460 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CGACTCTCCCGGAAGTACATTTAC -3'
(R):5'- ACCTTCTTCAGCGTGTCCAG -3'

Sequencing Primer
(F):5'- CCGGAAGTACATTTACAGTCTCTAC -3'
(R):5'- CAGGTGCACGTTGATGGC -3'
Posted On 2018-06-22