Mutagenetix > Incidental Mutation

Incidental Mutation 'R6586:Dusp27'

524373

Institutional Source

Beutler Lab

Gene Symbol

Dusp27

Ensembl Gene

ENSMUSG00000026564

Gene Name

dual specificity phosphatase 27 (putative)

Synonyms

C130085G02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6586 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

166098148-166127922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 166100885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 386 (E386G)

Ref Sequence

ENSEMBL: ENSMUSP00000141564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]

AlphaFold

Q148W8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085992
AA Change: E386G

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: E386G

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192369
AA Change: E386G

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: E386G

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	T	C	4: 137,455,328	F265L	possibly damaging	Het
9930022D16Rik	A	G	11: 109,417,960	T51A	unknown	Het
Acaa1a	A	G	9: 119,349,538		probably null	Het
Clasp2	T	C	9: 113,813,264	S280P	probably damaging	Het
Cnga3	T	C	1: 37,261,278	S398P	probably damaging	Het
Cngb3	T	G	4: 19,280,946	L5R	probably damaging	Het
Cyp2c65	T	C	19: 39,082,218	F282L	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Dnm2	T	C	9: 21,505,646	F825S	probably benign	Het
Egfem1	T	A	3: 29,662,411	C343*	probably null	Het
Fah	T	A	7: 84,593,260	D280V	probably benign	Het
Fiz1	C	T	7: 5,008,401	A373T	possibly damaging	Het
Flg	A	T	3: 93,292,983		probably benign	Het
Flnb	A	G	14: 7,929,138	R1956G	possibly damaging	Het
Mterf2	A	G	10: 85,120,106	F218S	probably damaging	Het
Nlrp1a	A	G	11: 71,106,073	V868A	probably benign	Het
Nrip2	T	A	6: 128,404,948	C85*	probably null	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr107	G	A	17: 37,405,905	R119H	probably benign	Het
Olfr620	T	A	7: 103,611,976	I126F	possibly damaging	Het
Palm	A	C	10: 79,809,531	N111H	probably benign	Het
Pipox	T	C	11: 77,881,179	D373G	possibly damaging	Het
Plec	C	T	15: 76,175,087	G3540D	probably damaging	Het
Psd3	T	C	8: 67,963,545	T567A	probably damaging	Het
Psg28	T	C	7: 18,430,544	Y81C	probably damaging	Het
Rarres1	A	T	3: 67,491,033	N131K	probably damaging	Het
Rbbp8nl	G	A	2: 180,280,959	H214Y	probably damaging	Het
Tas2r135	A	G	6: 42,406,018	T164A	probably benign	Het
Tmco3	G	T	8: 13,320,894		probably benign	Het
Tnpo2	T	A	8: 85,045,202	M259K	possibly damaging	Het
Tns4	T	C	11: 99,080,267	R206G	probably benign	Het
Trim60	G	T	8: 65,000,596	L334I	possibly damaging	Het
Ttn	T	C	2: 76,730,410	T29216A	probably damaging	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Vmn1r60	T	A	7: 5,544,447	N218I	probably benign	Het
Vps25	T	G	11: 101,259,009	V125G	probably damaging	Het
Ythdc2	A	G	18: 44,845,788	D455G	probably benign	Het
Ythdf2	A	T	4: 132,205,600	M83K	probably benign	Het

Other mutations in Dusp27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Dusp27	APN	1	166100552	missense	probably benign	0.00
IGL00973:Dusp27	APN	1	166099458	missense	probably benign
IGL01331:Dusp27	APN	1	166108180	missense	probably damaging	1.00
IGL01466:Dusp27	APN	1	166100504	missense	probably damaging	1.00
IGL01572:Dusp27	APN	1	166100372	missense	probably benign	0.18
IGL01906:Dusp27	APN	1	166099523	missense	probably damaging	1.00
IGL01974:Dusp27	APN	1	166100536	nonsense	probably null
IGL02112:Dusp27	APN	1	166099671	nonsense	probably null
IGL02805:Dusp27	APN	1	166099061	missense	probably damaging	1.00
IGL03343:Dusp27	APN	1	166099448	missense	probably benign	0.00
R0116:Dusp27	UTSW	1	166099701	missense	probably benign	0.19
R0367:Dusp27	UTSW	1	166100763	missense	probably benign	0.05
R0499:Dusp27	UTSW	1	166099101	missense	probably benign	0.00
R0542:Dusp27	UTSW	1	166101284	missense	possibly damaging	0.90
R1312:Dusp27	UTSW	1	166099291	missense	possibly damaging	0.46
R1572:Dusp27	UTSW	1	166099455	missense	possibly damaging	0.68
R1598:Dusp27	UTSW	1	166110259	missense	probably benign	0.10
R1858:Dusp27	UTSW	1	166100846	missense	possibly damaging	0.87
R2021:Dusp27	UTSW	1	166100823	missense	probably benign	0.00
R2970:Dusp27	UTSW	1	166099229	missense	probably benign	0.04
R3727:Dusp27	UTSW	1	166099506	missense	probably damaging	1.00
R4041:Dusp27	UTSW	1	166100111	missense	probably benign	0.01
R4245:Dusp27	UTSW	1	166101116	missense	probably damaging	1.00
R4955:Dusp27	UTSW	1	166108092	missense	probably damaging	1.00
R4967:Dusp27	UTSW	1	166127106	missense	probably damaging	1.00
R5040:Dusp27	UTSW	1	166100345	missense	probably benign	0.17
R5342:Dusp27	UTSW	1	166110250	missense	probably benign	0.01
R5467:Dusp27	UTSW	1	166112030	critical splice donor site	probably null
R5742:Dusp27	UTSW	1	166099454	missense	probably benign	0.00
R6222:Dusp27	UTSW	1	166098645	missense	probably benign	0.26
R6239:Dusp27	UTSW	1	166098819	missense	probably damaging	1.00
R6531:Dusp27	UTSW	1	166110046	splice site	probably null
R6958:Dusp27	UTSW	1	166107996	missense	probably damaging	1.00
R7006:Dusp27	UTSW	1	166099094	missense	probably benign
R7111:Dusp27	UTSW	1	166127154	missense	possibly damaging	0.66
R7310:Dusp27	UTSW	1	166098731	missense	possibly damaging	0.46
R7312:Dusp27	UTSW	1	166127107	missense	probably damaging	0.99
R7378:Dusp27	UTSW	1	166112063	nonsense	probably null
R7398:Dusp27	UTSW	1	166100475	missense	probably damaging	1.00
R7442:Dusp27	UTSW	1	166101015	missense	probably benign	0.01
R7569:Dusp27	UTSW	1	166108035	missense	probably damaging	1.00
R7920:Dusp27	UTSW	1	166099896	missense	possibly damaging	0.72
R7954:Dusp27	UTSW	1	166099280	missense	probably benign	0.05
R7972:Dusp27	UTSW	1	166099139	missense	probably damaging	1.00
R8186:Dusp27	UTSW	1	166100079	missense	probably damaging	1.00
R8354:Dusp27	UTSW	1	166108133	missense	probably damaging	1.00
R8454:Dusp27	UTSW	1	166108133	missense	probably damaging	1.00
R8535:Dusp27	UTSW	1	166101161	missense	probably benign	0.01
R9419:Dusp27	UTSW	1	166100186	missense	probably damaging	1.00
R9493:Dusp27	UTSW	1	166098841	missense	probably damaging	1.00
R9694:Dusp27	UTSW	1	166101085	missense	probably damaging	1.00
Z1088:Dusp27	UTSW	1	166099283	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTCAGGATCCGGATGTCATG -3'
(R):5'- ATGATGCCACTAGCCACCTG -3'

Sequencing Primer
(F):5'- TGGCTGCTCACACTCTCAGAAG -3'
(R):5'- CTGAGTGGCTCCTCCTTGG -3'

Posted On

2018-06-22